ID: 1129162236

View in Genome Browser
Species Human (GRCh38)
Location 15:73753204-73753226
Sequence GCGCGGGCGGCGCGGCGCCG CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1129162236_1129162252 15 Left 1129162236 15:73753204-73753226 CCGCGGCGCCGCGCCGCCCGCGC No data
Right 1129162252 15:73753242-73753264 CCCGCCCCGCCGCCCCCCGCCGG No data
1129162236_1129162263 29 Left 1129162236 15:73753204-73753226 CCGCGGCGCCGCGCCGCCCGCGC No data
Right 1129162263 15:73753256-73753278 CCCCGCCGGACTGGCCGCCCGGG No data
1129162236_1129162256 20 Left 1129162236 15:73753204-73753226 CCGCGGCGCCGCGCCGCCCGCGC No data
Right 1129162256 15:73753247-73753269 CCCGCCGCCCCCCGCCGGACTGG No data
1129162236_1129162261 28 Left 1129162236 15:73753204-73753226 CCGCGGCGCCGCGCCGCCCGCGC No data
Right 1129162261 15:73753255-73753277 CCCCCGCCGGACTGGCCGCCCGG No data
1129162236_1129162240 -8 Left 1129162236 15:73753204-73753226 CCGCGGCGCCGCGCCGCCCGCGC No data
Right 1129162240 15:73753219-73753241 GCCCGCGCCCCGGCCGCCCCCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1129162236 Original CRISPR GCGCGGGCGGCGCGGCGCCG CGG (reversed) Intergenic