ID: 1129162237

View in Genome Browser
Species Human (GRCh38)
Location 15:73753209-73753231
Sequence GCGCCGCGCCGCCCGCGCCC CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 13 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1129162226_1129162237 17 Left 1129162226 15:73753169-73753191 CCGGGCTCCCGGGGCCTGGGCCC No data
Right 1129162237 15:73753209-73753231 GCGCCGCGCCGCCCGCGCCCCGG No data
1129162233_1129162237 -9 Left 1129162233 15:73753195-73753217 CCCCAAGCGCCGCGGCGCCGCGC No data
Right 1129162237 15:73753209-73753231 GCGCCGCGCCGCCCGCGCCCCGG No data
1129162228_1129162237 9 Left 1129162228 15:73753177-73753199 CCGGGGCCTGGGCCCGCTCCCCA No data
Right 1129162237 15:73753209-73753231 GCGCCGCGCCGCCCGCGCCCCGG No data
1129162227_1129162237 10 Left 1129162227 15:73753176-73753198 CCCGGGGCCTGGGCCCGCTCCCC No data
Right 1129162237 15:73753209-73753231 GCGCCGCGCCGCCCGCGCCCCGG No data
1129162219_1129162237 26 Left 1129162219 15:73753160-73753182 CCTGCCCCGCCGGGCTCCCGGGG No data
Right 1129162237 15:73753209-73753231 GCGCCGCGCCGCCCGCGCCCCGG No data
1129162229_1129162237 3 Left 1129162229 15:73753183-73753205 CCTGGGCCCGCTCCCCAAGCGCC No data
Right 1129162237 15:73753209-73753231 GCGCCGCGCCGCCCGCGCCCCGG No data
1129162222_1129162237 21 Left 1129162222 15:73753165-73753187 CCCGCCGGGCTCCCGGGGCCTGG No data
Right 1129162237 15:73753209-73753231 GCGCCGCGCCGCCCGCGCCCCGG No data
1129162232_1129162237 -4 Left 1129162232 15:73753190-73753212 CCGCTCCCCAAGCGCCGCGGCGC No data
Right 1129162237 15:73753209-73753231 GCGCCGCGCCGCCCGCGCCCCGG No data
1129162224_1129162237 20 Left 1129162224 15:73753166-73753188 CCGCCGGGCTCCCGGGGCCTGGG No data
Right 1129162237 15:73753209-73753231 GCGCCGCGCCGCCCGCGCCCCGG No data
1129162221_1129162237 22 Left 1129162221 15:73753164-73753186 CCCCGCCGGGCTCCCGGGGCCTG No data
Right 1129162237 15:73753209-73753231 GCGCCGCGCCGCCCGCGCCCCGG No data
1129162217_1129162237 27 Left 1129162217 15:73753159-73753181 CCCTGCCCCGCCGGGCTCCCGGG No data
Right 1129162237 15:73753209-73753231 GCGCCGCGCCGCCCGCGCCCCGG No data
1129162231_1129162237 -3 Left 1129162231 15:73753189-73753211 CCCGCTCCCCAAGCGCCGCGGCG No data
Right 1129162237 15:73753209-73753231 GCGCCGCGCCGCCCGCGCCCCGG No data
1129162234_1129162237 -10 Left 1129162234 15:73753196-73753218 CCCAAGCGCCGCGGCGCCGCGCC No data
Right 1129162237 15:73753209-73753231 GCGCCGCGCCGCCCGCGCCCCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1129162237 Original CRISPR GCGCCGCGCCGCCCGCGCCC CGG Intergenic
No off target data available for this crispr