ID: 1129162238

View in Genome Browser
Species Human (GRCh38)
Location 15:73753212-73753234
Sequence CGGCCGGGGCGCGGGCGGCG CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1129162238_1129162263 21 Left 1129162238 15:73753212-73753234 CCGCGCCGCCCGCGCCCCGGCCG No data
Right 1129162263 15:73753256-73753278 CCCCGCCGGACTGGCCGCCCGGG No data
1129162238_1129162267 25 Left 1129162238 15:73753212-73753234 CCGCGCCGCCCGCGCCCCGGCCG No data
Right 1129162267 15:73753260-73753282 GCCGGACTGGCCGCCCGGGCGGG No data
1129162238_1129162261 20 Left 1129162238 15:73753212-73753234 CCGCGCCGCCCGCGCCCCGGCCG No data
Right 1129162261 15:73753255-73753277 CCCCCGCCGGACTGGCCGCCCGG No data
1129162238_1129162256 12 Left 1129162238 15:73753212-73753234 CCGCGCCGCCCGCGCCCCGGCCG No data
Right 1129162256 15:73753247-73753269 CCCGCCGCCCCCCGCCGGACTGG No data
1129162238_1129162266 24 Left 1129162238 15:73753212-73753234 CCGCGCCGCCCGCGCCCCGGCCG No data
Right 1129162266 15:73753259-73753281 CGCCGGACTGGCCGCCCGGGCGG No data
1129162238_1129162252 7 Left 1129162238 15:73753212-73753234 CCGCGCCGCCCGCGCCCCGGCCG No data
Right 1129162252 15:73753242-73753264 CCCGCCCCGCCGCCCCCCGCCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1129162238 Original CRISPR CGGCCGGGGCGCGGGCGGCG CGG (reversed) Intergenic