ID: 1129162239

View in Genome Browser
Species Human (GRCh38)
Location 15:73753217-73753239
Sequence GGGGGCGGCCGGGGCGCGGG CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1129162239_1129162252 2 Left 1129162239 15:73753217-73753239 CCGCCCGCGCCCCGGCCGCCCCC No data
Right 1129162252 15:73753242-73753264 CCCGCCCCGCCGCCCCCCGCCGG No data
1129162239_1129162269 26 Left 1129162239 15:73753217-73753239 CCGCCCGCGCCCCGGCCGCCCCC No data
Right 1129162269 15:73753266-73753288 CTGGCCGCCCGGGCGGGCGCTGG No data
1129162239_1129162256 7 Left 1129162239 15:73753217-73753239 CCGCCCGCGCCCCGGCCGCCCCC No data
Right 1129162256 15:73753247-73753269 CCCGCCGCCCCCCGCCGGACTGG No data
1129162239_1129162263 16 Left 1129162239 15:73753217-73753239 CCGCCCGCGCCCCGGCCGCCCCC No data
Right 1129162263 15:73753256-73753278 CCCCGCCGGACTGGCCGCCCGGG No data
1129162239_1129162267 20 Left 1129162239 15:73753217-73753239 CCGCCCGCGCCCCGGCCGCCCCC No data
Right 1129162267 15:73753260-73753282 GCCGGACTGGCCGCCCGGGCGGG No data
1129162239_1129162266 19 Left 1129162239 15:73753217-73753239 CCGCCCGCGCCCCGGCCGCCCCC No data
Right 1129162266 15:73753259-73753281 CGCCGGACTGGCCGCCCGGGCGG No data
1129162239_1129162261 15 Left 1129162239 15:73753217-73753239 CCGCCCGCGCCCCGGCCGCCCCC No data
Right 1129162261 15:73753255-73753277 CCCCCGCCGGACTGGCCGCCCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1129162239 Original CRISPR GGGGGCGGCCGGGGCGCGGG CGG (reversed) Intergenic