ID: 1129162240

View in Genome Browser
Species Human (GRCh38)
Location 15:73753219-73753241
Sequence GCCCGCGCCCCGGCCGCCCC CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 11 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1129162234_1129162240 0 Left 1129162234 15:73753196-73753218 CCCAAGCGCCGCGGCGCCGCGCC No data
Right 1129162240 15:73753219-73753241 GCCCGCGCCCCGGCCGCCCCCGG No data
1129162233_1129162240 1 Left 1129162233 15:73753195-73753217 CCCCAAGCGCCGCGGCGCCGCGC No data
Right 1129162240 15:73753219-73753241 GCCCGCGCCCCGGCCGCCCCCGG No data
1129162229_1129162240 13 Left 1129162229 15:73753183-73753205 CCTGGGCCCGCTCCCCAAGCGCC No data
Right 1129162240 15:73753219-73753241 GCCCGCGCCCCGGCCGCCCCCGG No data
1129162224_1129162240 30 Left 1129162224 15:73753166-73753188 CCGCCGGGCTCCCGGGGCCTGGG No data
Right 1129162240 15:73753219-73753241 GCCCGCGCCCCGGCCGCCCCCGG No data
1129162236_1129162240 -8 Left 1129162236 15:73753204-73753226 CCGCGGCGCCGCGCCGCCCGCGC No data
Right 1129162240 15:73753219-73753241 GCCCGCGCCCCGGCCGCCCCCGG No data
1129162228_1129162240 19 Left 1129162228 15:73753177-73753199 CCGGGGCCTGGGCCCGCTCCCCA No data
Right 1129162240 15:73753219-73753241 GCCCGCGCCCCGGCCGCCCCCGG No data
1129162227_1129162240 20 Left 1129162227 15:73753176-73753198 CCCGGGGCCTGGGCCCGCTCCCC No data
Right 1129162240 15:73753219-73753241 GCCCGCGCCCCGGCCGCCCCCGG No data
1129162232_1129162240 6 Left 1129162232 15:73753190-73753212 CCGCTCCCCAAGCGCCGCGGCGC No data
Right 1129162240 15:73753219-73753241 GCCCGCGCCCCGGCCGCCCCCGG No data
1129162231_1129162240 7 Left 1129162231 15:73753189-73753211 CCCGCTCCCCAAGCGCCGCGGCG No data
Right 1129162240 15:73753219-73753241 GCCCGCGCCCCGGCCGCCCCCGG No data
1129162226_1129162240 27 Left 1129162226 15:73753169-73753191 CCGGGCTCCCGGGGCCTGGGCCC No data
Right 1129162240 15:73753219-73753241 GCCCGCGCCCCGGCCGCCCCCGG No data
1129162235_1129162240 -1 Left 1129162235 15:73753197-73753219 CCAAGCGCCGCGGCGCCGCGCCG No data
Right 1129162240 15:73753219-73753241 GCCCGCGCCCCGGCCGCCCCCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1129162240 Original CRISPR GCCCGCGCCCCGGCCGCCCC CGG Intergenic
No off target data available for this crispr