ID: 1129162241

View in Genome Browser
Species Human (GRCh38)
Location 15:73753220-73753242
Sequence GCCGGGGGCGGCCGGGGCGC GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1129162241_1129162266 16 Left 1129162241 15:73753220-73753242 CCCGCGCCCCGGCCGCCCCCGGC No data
Right 1129162266 15:73753259-73753281 CGCCGGACTGGCCGCCCGGGCGG No data
1129162241_1129162261 12 Left 1129162241 15:73753220-73753242 CCCGCGCCCCGGCCGCCCCCGGC No data
Right 1129162261 15:73753255-73753277 CCCCCGCCGGACTGGCCGCCCGG No data
1129162241_1129162252 -1 Left 1129162241 15:73753220-73753242 CCCGCGCCCCGGCCGCCCCCGGC No data
Right 1129162252 15:73753242-73753264 CCCGCCCCGCCGCCCCCCGCCGG No data
1129162241_1129162267 17 Left 1129162241 15:73753220-73753242 CCCGCGCCCCGGCCGCCCCCGGC No data
Right 1129162267 15:73753260-73753282 GCCGGACTGGCCGCCCGGGCGGG No data
1129162241_1129162269 23 Left 1129162241 15:73753220-73753242 CCCGCGCCCCGGCCGCCCCCGGC No data
Right 1129162269 15:73753266-73753288 CTGGCCGCCCGGGCGGGCGCTGG No data
1129162241_1129162256 4 Left 1129162241 15:73753220-73753242 CCCGCGCCCCGGCCGCCCCCGGC No data
Right 1129162256 15:73753247-73753269 CCCGCCGCCCCCCGCCGGACTGG No data
1129162241_1129162263 13 Left 1129162241 15:73753220-73753242 CCCGCGCCCCGGCCGCCCCCGGC No data
Right 1129162263 15:73753256-73753278 CCCCGCCGGACTGGCCGCCCGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1129162241 Original CRISPR GCCGGGGGCGGCCGGGGCGC GGG (reversed) Intergenic
No off target data available for this crispr