ID: 1129162246

View in Genome Browser
Species Human (GRCh38)
Location 15:73753232-73753254
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1129162246_1129162273 23 Left 1129162246 15:73753232-73753254 CCGCCCCCGGCCCGCCCCGCCGC No data
Right 1129162273 15:73753278-73753300 GCGGGCGCTGGCTCCCTTAAAGG No data
1129162246_1129162267 5 Left 1129162246 15:73753232-73753254 CCGCCCCCGGCCCGCCCCGCCGC No data
Right 1129162267 15:73753260-73753282 GCCGGACTGGCCGCCCGGGCGGG No data
1129162246_1129162266 4 Left 1129162246 15:73753232-73753254 CCGCCCCCGGCCCGCCCCGCCGC No data
Right 1129162266 15:73753259-73753281 CGCCGGACTGGCCGCCCGGGCGG No data
1129162246_1129162263 1 Left 1129162246 15:73753232-73753254 CCGCCCCCGGCCCGCCCCGCCGC No data
Right 1129162263 15:73753256-73753278 CCCCGCCGGACTGGCCGCCCGGG No data
1129162246_1129162269 11 Left 1129162246 15:73753232-73753254 CCGCCCCCGGCCCGCCCCGCCGC No data
Right 1129162269 15:73753266-73753288 CTGGCCGCCCGGGCGGGCGCTGG No data
1129162246_1129162261 0 Left 1129162246 15:73753232-73753254 CCGCCCCCGGCCCGCCCCGCCGC No data
Right 1129162261 15:73753255-73753277 CCCCCGCCGGACTGGCCGCCCGG No data
1129162246_1129162256 -8 Left 1129162246 15:73753232-73753254 CCGCCCCCGGCCCGCCCCGCCGC No data
Right 1129162256 15:73753247-73753269 CCCGCCGCCCCCCGCCGGACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1129162246 Original CRISPR GCGGCGGGGCGGGCCGGGGG CGG (reversed) Intergenic