ID: 1129162248

View in Genome Browser
Species Human (GRCh38)
Location 15:73753236-73753258
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1129162248_1129162273 19 Left 1129162248 15:73753236-73753258 CCCCGGCCCGCCCCGCCGCCCCC No data
Right 1129162273 15:73753278-73753300 GCGGGCGCTGGCTCCCTTAAAGG No data
1129162248_1129162274 27 Left 1129162248 15:73753236-73753258 CCCCGGCCCGCCCCGCCGCCCCC No data
Right 1129162274 15:73753286-73753308 TGGCTCCCTTAAAGGCCGCCCGG No data
1129162248_1129162263 -3 Left 1129162248 15:73753236-73753258 CCCCGGCCCGCCCCGCCGCCCCC No data
Right 1129162263 15:73753256-73753278 CCCCGCCGGACTGGCCGCCCGGG No data
1129162248_1129162267 1 Left 1129162248 15:73753236-73753258 CCCCGGCCCGCCCCGCCGCCCCC No data
Right 1129162267 15:73753260-73753282 GCCGGACTGGCCGCCCGGGCGGG No data
1129162248_1129162266 0 Left 1129162248 15:73753236-73753258 CCCCGGCCCGCCCCGCCGCCCCC No data
Right 1129162266 15:73753259-73753281 CGCCGGACTGGCCGCCCGGGCGG No data
1129162248_1129162261 -4 Left 1129162248 15:73753236-73753258 CCCCGGCCCGCCCCGCCGCCCCC No data
Right 1129162261 15:73753255-73753277 CCCCCGCCGGACTGGCCGCCCGG No data
1129162248_1129162269 7 Left 1129162248 15:73753236-73753258 CCCCGGCCCGCCCCGCCGCCCCC No data
Right 1129162269 15:73753266-73753288 CTGGCCGCCCGGGCGGGCGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1129162248 Original CRISPR GGGGGCGGCGGGGCGGGCCG GGG (reversed) Intergenic