ID: 1129162252

View in Genome Browser
Species Human (GRCh38)
Location 15:73753242-73753264
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic

Found 13 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1129162241_1129162252 -1 Left 1129162241 15:73753220-73753242 CCCGCGCCCCGGCCGCCCCCGGC No data
Right 1129162252 15:73753242-73753264 CCCGCCCCGCCGCCCCCCGCCGG No data
1129162234_1129162252 23 Left 1129162234 15:73753196-73753218 CCCAAGCGCCGCGGCGCCGCGCC No data
Right 1129162252 15:73753242-73753264 CCCGCCCCGCCGCCCCCCGCCGG No data
1129162231_1129162252 30 Left 1129162231 15:73753189-73753211 CCCGCTCCCCAAGCGCCGCGGCG No data
Right 1129162252 15:73753242-73753264 CCCGCCCCGCCGCCCCCCGCCGG No data
1129162233_1129162252 24 Left 1129162233 15:73753195-73753217 CCCCAAGCGCCGCGGCGCCGCGC No data
Right 1129162252 15:73753242-73753264 CCCGCCCCGCCGCCCCCCGCCGG No data
1129162238_1129162252 7 Left 1129162238 15:73753212-73753234 CCGCGCCGCCCGCGCCCCGGCCG No data
Right 1129162252 15:73753242-73753264 CCCGCCCCGCCGCCCCCCGCCGG No data
1129162235_1129162252 22 Left 1129162235 15:73753197-73753219 CCAAGCGCCGCGGCGCCGCGCCG No data
Right 1129162252 15:73753242-73753264 CCCGCCCCGCCGCCCCCCGCCGG No data
1129162232_1129162252 29 Left 1129162232 15:73753190-73753212 CCGCTCCCCAAGCGCCGCGGCGC No data
Right 1129162252 15:73753242-73753264 CCCGCCCCGCCGCCCCCCGCCGG No data
1129162244_1129162252 -8 Left 1129162244 15:73753227-73753249 CCCGGCCGCCCCCGGCCCGCCCC No data
Right 1129162252 15:73753242-73753264 CCCGCCCCGCCGCCCCCCGCCGG No data
1129162245_1129162252 -9 Left 1129162245 15:73753228-73753250 CCGGCCGCCCCCGGCCCGCCCCG No data
Right 1129162252 15:73753242-73753264 CCCGCCCCGCCGCCCCCCGCCGG No data
1129162239_1129162252 2 Left 1129162239 15:73753217-73753239 CCGCCCGCGCCCCGGCCGCCCCC No data
Right 1129162252 15:73753242-73753264 CCCGCCCCGCCGCCCCCCGCCGG No data
1129162236_1129162252 15 Left 1129162236 15:73753204-73753226 CCGCGGCGCCGCGCCGCCCGCGC No data
Right 1129162252 15:73753242-73753264 CCCGCCCCGCCGCCCCCCGCCGG No data
1129162242_1129162252 -2 Left 1129162242 15:73753221-73753243 CCGCGCCCCGGCCGCCCCCGGCC No data
Right 1129162252 15:73753242-73753264 CCCGCCCCGCCGCCCCCCGCCGG No data
1129162243_1129162252 -7 Left 1129162243 15:73753226-73753248 CCCCGGCCGCCCCCGGCCCGCCC No data
Right 1129162252 15:73753242-73753264 CCCGCCCCGCCGCCCCCCGCCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1129162252 Original CRISPR CCCGCCCCGCCGCCCCCCGC CGG Intergenic