ID: 1129162253

View in Genome Browser
Species Human (GRCh38)
Location 15:73753243-73753265
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1129162253_1129162269 0 Left 1129162253 15:73753243-73753265 CCGCCCCGCCGCCCCCCGCCGGA No data
Right 1129162269 15:73753266-73753288 CTGGCCGCCCGGGCGGGCGCTGG No data
1129162253_1129162273 12 Left 1129162253 15:73753243-73753265 CCGCCCCGCCGCCCCCCGCCGGA No data
Right 1129162273 15:73753278-73753300 GCGGGCGCTGGCTCCCTTAAAGG No data
1129162253_1129162263 -10 Left 1129162253 15:73753243-73753265 CCGCCCCGCCGCCCCCCGCCGGA No data
Right 1129162263 15:73753256-73753278 CCCCGCCGGACTGGCCGCCCGGG No data
1129162253_1129162277 29 Left 1129162253 15:73753243-73753265 CCGCCCCGCCGCCCCCCGCCGGA No data
Right 1129162277 15:73753295-73753317 TAAAGGCCGCCCGGCTCGCTTGG No data
1129162253_1129162274 20 Left 1129162253 15:73753243-73753265 CCGCCCCGCCGCCCCCCGCCGGA No data
Right 1129162274 15:73753286-73753308 TGGCTCCCTTAAAGGCCGCCCGG No data
1129162253_1129162267 -6 Left 1129162253 15:73753243-73753265 CCGCCCCGCCGCCCCCCGCCGGA No data
Right 1129162267 15:73753260-73753282 GCCGGACTGGCCGCCCGGGCGGG No data
1129162253_1129162266 -7 Left 1129162253 15:73753243-73753265 CCGCCCCGCCGCCCCCCGCCGGA No data
Right 1129162266 15:73753259-73753281 CGCCGGACTGGCCGCCCGGGCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1129162253 Original CRISPR TCCGGCGGGGGGCGGCGGGG CGG (reversed) Intergenic