ID: 1129162255

View in Genome Browser
Species Human (GRCh38)
Location 15:73753247-73753269
Sequence CCAGTCCGGCGGGGGGCGGC GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 313
Summary {0: 1, 1: 0, 2: 2, 3: 46, 4: 264}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1129162255_1129162269 -4 Left 1129162255 15:73753247-73753269 CCCGCCGCCCCCCGCCGGACTGG 0: 1
1: 0
2: 2
3: 46
4: 264
Right 1129162269 15:73753266-73753288 CTGGCCGCCCGGGCGGGCGCTGG No data
1129162255_1129162277 25 Left 1129162255 15:73753247-73753269 CCCGCCGCCCCCCGCCGGACTGG 0: 1
1: 0
2: 2
3: 46
4: 264
Right 1129162277 15:73753295-73753317 TAAAGGCCGCCCGGCTCGCTTGG No data
1129162255_1129162267 -10 Left 1129162255 15:73753247-73753269 CCCGCCGCCCCCCGCCGGACTGG 0: 1
1: 0
2: 2
3: 46
4: 264
Right 1129162267 15:73753260-73753282 GCCGGACTGGCCGCCCGGGCGGG No data
1129162255_1129162274 16 Left 1129162255 15:73753247-73753269 CCCGCCGCCCCCCGCCGGACTGG 0: 1
1: 0
2: 2
3: 46
4: 264
Right 1129162274 15:73753286-73753308 TGGCTCCCTTAAAGGCCGCCCGG No data
1129162255_1129162273 8 Left 1129162255 15:73753247-73753269 CCCGCCGCCCCCCGCCGGACTGG 0: 1
1: 0
2: 2
3: 46
4: 264
Right 1129162273 15:73753278-73753300 GCGGGCGCTGGCTCCCTTAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1129162255 Original CRISPR CCAGTCCGGCGGGGGGCGGC GGG (reversed) Intergenic