ID: 1129162263

View in Genome Browser
Species Human (GRCh38)
Location 15:73753256-73753278
Sequence CCCCGCCGGACTGGCCGCCC GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 15 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1129162246_1129162263 1 Left 1129162246 15:73753232-73753254 CCGCCCCCGGCCCGCCCCGCCGC No data
Right 1129162263 15:73753256-73753278 CCCCGCCGGACTGGCCGCCCGGG No data
1129162250_1129162263 -5 Left 1129162250 15:73753238-73753260 CCGGCCCGCCCCGCCGCCCCCCG No data
Right 1129162263 15:73753256-73753278 CCCCGCCGGACTGGCCGCCCGGG No data
1129162243_1129162263 7 Left 1129162243 15:73753226-73753248 CCCCGGCCGCCCCCGGCCCGCCC No data
Right 1129162263 15:73753256-73753278 CCCCGCCGGACTGGCCGCCCGGG No data
1129162241_1129162263 13 Left 1129162241 15:73753220-73753242 CCCGCGCCCCGGCCGCCCCCGGC No data
Right 1129162263 15:73753256-73753278 CCCCGCCGGACTGGCCGCCCGGG No data
1129162248_1129162263 -3 Left 1129162248 15:73753236-73753258 CCCCGGCCCGCCCCGCCGCCCCC No data
Right 1129162263 15:73753256-73753278 CCCCGCCGGACTGGCCGCCCGGG No data
1129162239_1129162263 16 Left 1129162239 15:73753217-73753239 CCGCCCGCGCCCCGGCCGCCCCC No data
Right 1129162263 15:73753256-73753278 CCCCGCCGGACTGGCCGCCCGGG No data
1129162247_1129162263 -2 Left 1129162247 15:73753235-73753257 CCCCCGGCCCGCCCCGCCGCCCC 0: 1
1: 6
2: 69
3: 4242
4: 7001
Right 1129162263 15:73753256-73753278 CCCCGCCGGACTGGCCGCCCGGG No data
1129162253_1129162263 -10 Left 1129162253 15:73753243-73753265 CCGCCCCGCCGCCCCCCGCCGGA No data
Right 1129162263 15:73753256-73753278 CCCCGCCGGACTGGCCGCCCGGG No data
1129162251_1129162263 -9 Left 1129162251 15:73753242-73753264 CCCGCCCCGCCGCCCCCCGCCGG No data
Right 1129162263 15:73753256-73753278 CCCCGCCGGACTGGCCGCCCGGG No data
1129162245_1129162263 5 Left 1129162245 15:73753228-73753250 CCGGCCGCCCCCGGCCCGCCCCG No data
Right 1129162263 15:73753256-73753278 CCCCGCCGGACTGGCCGCCCGGG No data
1129162236_1129162263 29 Left 1129162236 15:73753204-73753226 CCGCGGCGCCGCGCCGCCCGCGC No data
Right 1129162263 15:73753256-73753278 CCCCGCCGGACTGGCCGCCCGGG No data
1129162238_1129162263 21 Left 1129162238 15:73753212-73753234 CCGCGCCGCCCGCGCCCCGGCCG No data
Right 1129162263 15:73753256-73753278 CCCCGCCGGACTGGCCGCCCGGG No data
1129162249_1129162263 -4 Left 1129162249 15:73753237-73753259 CCCGGCCCGCCCCGCCGCCCCCC No data
Right 1129162263 15:73753256-73753278 CCCCGCCGGACTGGCCGCCCGGG No data
1129162242_1129162263 12 Left 1129162242 15:73753221-73753243 CCGCGCCCCGGCCGCCCCCGGCC No data
Right 1129162263 15:73753256-73753278 CCCCGCCGGACTGGCCGCCCGGG No data
1129162244_1129162263 6 Left 1129162244 15:73753227-73753249 CCCGGCCGCCCCCGGCCCGCCCC No data
Right 1129162263 15:73753256-73753278 CCCCGCCGGACTGGCCGCCCGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1129162263 Original CRISPR CCCCGCCGGACTGGCCGCCC GGG Intergenic