ID: 1129162266

View in Genome Browser
Species Human (GRCh38)
Location 15:73753259-73753281
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic

Found 15 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1129162243_1129162266 10 Left 1129162243 15:73753226-73753248 CCCCGGCCGCCCCCGGCCCGCCC No data
Right 1129162266 15:73753259-73753281 CGCCGGACTGGCCGCCCGGGCGG No data
1129162247_1129162266 1 Left 1129162247 15:73753235-73753257 CCCCCGGCCCGCCCCGCCGCCCC No data
Right 1129162266 15:73753259-73753281 CGCCGGACTGGCCGCCCGGGCGG No data
1129162245_1129162266 8 Left 1129162245 15:73753228-73753250 CCGGCCGCCCCCGGCCCGCCCCG No data
Right 1129162266 15:73753259-73753281 CGCCGGACTGGCCGCCCGGGCGG No data
1129162249_1129162266 -1 Left 1129162249 15:73753237-73753259 CCCGGCCCGCCCCGCCGCCCCCC No data
Right 1129162266 15:73753259-73753281 CGCCGGACTGGCCGCCCGGGCGG No data
1129162250_1129162266 -2 Left 1129162250 15:73753238-73753260 CCGGCCCGCCCCGCCGCCCCCCG No data
Right 1129162266 15:73753259-73753281 CGCCGGACTGGCCGCCCGGGCGG No data
1129162246_1129162266 4 Left 1129162246 15:73753232-73753254 CCGCCCCCGGCCCGCCCCGCCGC No data
Right 1129162266 15:73753259-73753281 CGCCGGACTGGCCGCCCGGGCGG No data
1129162238_1129162266 24 Left 1129162238 15:73753212-73753234 CCGCGCCGCCCGCGCCCCGGCCG No data
Right 1129162266 15:73753259-73753281 CGCCGGACTGGCCGCCCGGGCGG No data
1129162251_1129162266 -6 Left 1129162251 15:73753242-73753264 CCCGCCCCGCCGCCCCCCGCCGG No data
Right 1129162266 15:73753259-73753281 CGCCGGACTGGCCGCCCGGGCGG No data
1129162254_1129162266 -10 Left 1129162254 15:73753246-73753268 CCCCGCCGCCCCCCGCCGGACTG No data
Right 1129162266 15:73753259-73753281 CGCCGGACTGGCCGCCCGGGCGG No data
1129162244_1129162266 9 Left 1129162244 15:73753227-73753249 CCCGGCCGCCCCCGGCCCGCCCC No data
Right 1129162266 15:73753259-73753281 CGCCGGACTGGCCGCCCGGGCGG No data
1129162239_1129162266 19 Left 1129162239 15:73753217-73753239 CCGCCCGCGCCCCGGCCGCCCCC No data
Right 1129162266 15:73753259-73753281 CGCCGGACTGGCCGCCCGGGCGG No data
1129162242_1129162266 15 Left 1129162242 15:73753221-73753243 CCGCGCCCCGGCCGCCCCCGGCC No data
Right 1129162266 15:73753259-73753281 CGCCGGACTGGCCGCCCGGGCGG No data
1129162241_1129162266 16 Left 1129162241 15:73753220-73753242 CCCGCGCCCCGGCCGCCCCCGGC No data
Right 1129162266 15:73753259-73753281 CGCCGGACTGGCCGCCCGGGCGG No data
1129162248_1129162266 0 Left 1129162248 15:73753236-73753258 CCCCGGCCCGCCCCGCCGCCCCC No data
Right 1129162266 15:73753259-73753281 CGCCGGACTGGCCGCCCGGGCGG No data
1129162253_1129162266 -7 Left 1129162253 15:73753243-73753265 CCGCCCCGCCGCCCCCCGCCGGA No data
Right 1129162266 15:73753259-73753281 CGCCGGACTGGCCGCCCGGGCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1129162266 Original CRISPR CGCCGGACTGGCCGCCCGGG CGG Intergenic