ID: 1129162273

View in Genome Browser
Species Human (GRCh38)
Location 15:73753278-73753300
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic

Found 20 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1129162251_1129162273 13 Left 1129162251 15:73753242-73753264 CCCGCCCCGCCGCCCCCCGCCGG No data
Right 1129162273 15:73753278-73753300 GCGGGCGCTGGCTCCCTTAAAGG No data
1129162244_1129162273 28 Left 1129162244 15:73753227-73753249 CCCGGCCGCCCCCGGCCCGCCCC No data
Right 1129162273 15:73753278-73753300 GCGGGCGCTGGCTCCCTTAAAGG No data
1129162254_1129162273 9 Left 1129162254 15:73753246-73753268 CCCCGCCGCCCCCCGCCGGACTG No data
Right 1129162273 15:73753278-73753300 GCGGGCGCTGGCTCCCTTAAAGG No data
1129162265_1129162273 -3 Left 1129162265 15:73753258-73753280 CCGCCGGACTGGCCGCCCGGGCG No data
Right 1129162273 15:73753278-73753300 GCGGGCGCTGGCTCCCTTAAAGG No data
1129162264_1129162273 -2 Left 1129162264 15:73753257-73753279 CCCGCCGGACTGGCCGCCCGGGC No data
Right 1129162273 15:73753278-73753300 GCGGGCGCTGGCTCCCTTAAAGG No data
1129162250_1129162273 17 Left 1129162250 15:73753238-73753260 CCGGCCCGCCCCGCCGCCCCCCG No data
Right 1129162273 15:73753278-73753300 GCGGGCGCTGGCTCCCTTAAAGG No data
1129162246_1129162273 23 Left 1129162246 15:73753232-73753254 CCGCCCCCGGCCCGCCCCGCCGC No data
Right 1129162273 15:73753278-73753300 GCGGGCGCTGGCTCCCTTAAAGG No data
1129162259_1129162273 1 Left 1129162259 15:73753254-73753276 CCCCCCGCCGGACTGGCCGCCCG No data
Right 1129162273 15:73753278-73753300 GCGGGCGCTGGCTCCCTTAAAGG No data
1129162245_1129162273 27 Left 1129162245 15:73753228-73753250 CCGGCCGCCCCCGGCCCGCCCCG No data
Right 1129162273 15:73753278-73753300 GCGGGCGCTGGCTCCCTTAAAGG No data
1129162248_1129162273 19 Left 1129162248 15:73753236-73753258 CCCCGGCCCGCCCCGCCGCCCCC No data
Right 1129162273 15:73753278-73753300 GCGGGCGCTGGCTCCCTTAAAGG No data
1129162268_1129162273 -6 Left 1129162268 15:73753261-73753283 CCGGACTGGCCGCCCGGGCGGGC No data
Right 1129162273 15:73753278-73753300 GCGGGCGCTGGCTCCCTTAAAGG No data
1129162247_1129162273 20 Left 1129162247 15:73753235-73753257 CCCCCGGCCCGCCCCGCCGCCCC 0: 1
1: 6
2: 69
3: 4242
4: 7001
Right 1129162273 15:73753278-73753300 GCGGGCGCTGGCTCCCTTAAAGG No data
1129162258_1129162273 4 Left 1129162258 15:73753251-73753273 CCGCCCCCCGCCGGACTGGCCGC No data
Right 1129162273 15:73753278-73753300 GCGGGCGCTGGCTCCCTTAAAGG No data
1129162249_1129162273 18 Left 1129162249 15:73753237-73753259 CCCGGCCCGCCCCGCCGCCCCCC No data
Right 1129162273 15:73753278-73753300 GCGGGCGCTGGCTCCCTTAAAGG No data
1129162262_1129162273 -1 Left 1129162262 15:73753256-73753278 CCCCGCCGGACTGGCCGCCCGGG No data
Right 1129162273 15:73753278-73753300 GCGGGCGCTGGCTCCCTTAAAGG No data
1129162253_1129162273 12 Left 1129162253 15:73753243-73753265 CCGCCCCGCCGCCCCCCGCCGGA No data
Right 1129162273 15:73753278-73753300 GCGGGCGCTGGCTCCCTTAAAGG No data
1129162243_1129162273 29 Left 1129162243 15:73753226-73753248 CCCCGGCCGCCCCCGGCCCGCCC No data
Right 1129162273 15:73753278-73753300 GCGGGCGCTGGCTCCCTTAAAGG No data
1129162260_1129162273 0 Left 1129162260 15:73753255-73753277 CCCCCGCCGGACTGGCCGCCCGG No data
Right 1129162273 15:73753278-73753300 GCGGGCGCTGGCTCCCTTAAAGG No data
1129162257_1129162273 7 Left 1129162257 15:73753248-73753270 CCGCCGCCCCCCGCCGGACTGGC No data
Right 1129162273 15:73753278-73753300 GCGGGCGCTGGCTCCCTTAAAGG No data
1129162255_1129162273 8 Left 1129162255 15:73753247-73753269 CCCGCCGCCCCCCGCCGGACTGG 0: 1
1: 0
2: 2
3: 46
4: 264
Right 1129162273 15:73753278-73753300 GCGGGCGCTGGCTCCCTTAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1129162273 Original CRISPR GCGGGCGCTGGCTCCCTTAA AGG Intergenic