ID: 1129162274

View in Genome Browser
Species Human (GRCh38)
Location 15:73753286-73753308
Sequence TGGCTCCCTTAAAGGCCGCC CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 18 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1129162264_1129162274 6 Left 1129162264 15:73753257-73753279 CCCGCCGGACTGGCCGCCCGGGC No data
Right 1129162274 15:73753286-73753308 TGGCTCCCTTAAAGGCCGCCCGG No data
1129162250_1129162274 25 Left 1129162250 15:73753238-73753260 CCGGCCCGCCCCGCCGCCCCCCG No data
Right 1129162274 15:73753286-73753308 TGGCTCCCTTAAAGGCCGCCCGG No data
1129162253_1129162274 20 Left 1129162253 15:73753243-73753265 CCGCCCCGCCGCCCCCCGCCGGA No data
Right 1129162274 15:73753286-73753308 TGGCTCCCTTAAAGGCCGCCCGG No data
1129162258_1129162274 12 Left 1129162258 15:73753251-73753273 CCGCCCCCCGCCGGACTGGCCGC No data
Right 1129162274 15:73753286-73753308 TGGCTCCCTTAAAGGCCGCCCGG No data
1129162249_1129162274 26 Left 1129162249 15:73753237-73753259 CCCGGCCCGCCCCGCCGCCCCCC No data
Right 1129162274 15:73753286-73753308 TGGCTCCCTTAAAGGCCGCCCGG No data
1129162247_1129162274 28 Left 1129162247 15:73753235-73753257 CCCCCGGCCCGCCCCGCCGCCCC No data
Right 1129162274 15:73753286-73753308 TGGCTCCCTTAAAGGCCGCCCGG No data
1129162248_1129162274 27 Left 1129162248 15:73753236-73753258 CCCCGGCCCGCCCCGCCGCCCCC No data
Right 1129162274 15:73753286-73753308 TGGCTCCCTTAAAGGCCGCCCGG No data
1129162257_1129162274 15 Left 1129162257 15:73753248-73753270 CCGCCGCCCCCCGCCGGACTGGC No data
Right 1129162274 15:73753286-73753308 TGGCTCCCTTAAAGGCCGCCCGG No data
1129162265_1129162274 5 Left 1129162265 15:73753258-73753280 CCGCCGGACTGGCCGCCCGGGCG No data
Right 1129162274 15:73753286-73753308 TGGCTCCCTTAAAGGCCGCCCGG No data
1129162260_1129162274 8 Left 1129162260 15:73753255-73753277 CCCCCGCCGGACTGGCCGCCCGG No data
Right 1129162274 15:73753286-73753308 TGGCTCCCTTAAAGGCCGCCCGG No data
1129162271_1129162274 -10 Left 1129162271 15:73753273-73753295 CCCGGGCGGGCGCTGGCTCCCTT No data
Right 1129162274 15:73753286-73753308 TGGCTCCCTTAAAGGCCGCCCGG No data
1129162270_1129162274 -7 Left 1129162270 15:73753270-73753292 CCGCCCGGGCGGGCGCTGGCTCC No data
Right 1129162274 15:73753286-73753308 TGGCTCCCTTAAAGGCCGCCCGG No data
1129162259_1129162274 9 Left 1129162259 15:73753254-73753276 CCCCCCGCCGGACTGGCCGCCCG No data
Right 1129162274 15:73753286-73753308 TGGCTCCCTTAAAGGCCGCCCGG No data
1129162254_1129162274 17 Left 1129162254 15:73753246-73753268 CCCCGCCGCCCCCCGCCGGACTG No data
Right 1129162274 15:73753286-73753308 TGGCTCCCTTAAAGGCCGCCCGG No data
1129162262_1129162274 7 Left 1129162262 15:73753256-73753278 CCCCGCCGGACTGGCCGCCCGGG No data
Right 1129162274 15:73753286-73753308 TGGCTCCCTTAAAGGCCGCCCGG No data
1129162268_1129162274 2 Left 1129162268 15:73753261-73753283 CCGGACTGGCCGCCCGGGCGGGC No data
Right 1129162274 15:73753286-73753308 TGGCTCCCTTAAAGGCCGCCCGG No data
1129162255_1129162274 16 Left 1129162255 15:73753247-73753269 CCCGCCGCCCCCCGCCGGACTGG No data
Right 1129162274 15:73753286-73753308 TGGCTCCCTTAAAGGCCGCCCGG No data
1129162251_1129162274 21 Left 1129162251 15:73753242-73753264 CCCGCCCCGCCGCCCCCCGCCGG No data
Right 1129162274 15:73753286-73753308 TGGCTCCCTTAAAGGCCGCCCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1129162274 Original CRISPR TGGCTCCCTTAAAGGCCGCC CGG Intergenic