ID: 1129162402

View in Genome Browser
Species Human (GRCh38)
Location 15:73753746-73753768
Sequence GCTCTGGGTCGGCAGGGCTG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1129162390_1129162402 9 Left 1129162390 15:73753714-73753736 CCAACCTTTCCTGAGAACCTACT No data
Right 1129162402 15:73753746-73753768 GCTCTGGGTCGGCAGGGCTGGGG No data
1129162391_1129162402 5 Left 1129162391 15:73753718-73753740 CCTTTCCTGAGAACCTACTGTGT No data
Right 1129162402 15:73753746-73753768 GCTCTGGGTCGGCAGGGCTGGGG No data
1129162394_1129162402 -8 Left 1129162394 15:73753731-73753753 CCTACTGTGTGCCAAGCTCTGGG No data
Right 1129162402 15:73753746-73753768 GCTCTGGGTCGGCAGGGCTGGGG No data
1129162392_1129162402 0 Left 1129162392 15:73753723-73753745 CCTGAGAACCTACTGTGTGCCAA No data
Right 1129162402 15:73753746-73753768 GCTCTGGGTCGGCAGGGCTGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1129162402 Original CRISPR GCTCTGGGTCGGCAGGGCTG GGG Intergenic
No off target data available for this crispr