ID: 1129162990

View in Genome Browser
Species Human (GRCh38)
Location 15:73757630-73757652
Sequence GGTCCCAACCCTCTGGCTTC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 11 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1129162990_1129162992 -10 Left 1129162990 15:73757630-73757652 CCTGAAGCCAGAGGGTTGGGACC No data
Right 1129162992 15:73757643-73757665 GGTTGGGACCTGCTGCCCTGTGG No data
1129162990_1129162993 -4 Left 1129162990 15:73757630-73757652 CCTGAAGCCAGAGGGTTGGGACC No data
Right 1129162993 15:73757649-73757671 GACCTGCTGCCCTGTGGCCATGG No data
1129162990_1129163006 18 Left 1129162990 15:73757630-73757652 CCTGAAGCCAGAGGGTTGGGACC No data
Right 1129163006 15:73757671-73757693 GAGGGGAAGTGGGGGCATTTGGG No data
1129162990_1129163001 8 Left 1129162990 15:73757630-73757652 CCTGAAGCCAGAGGGTTGGGACC No data
Right 1129163001 15:73757661-73757683 TGTGGCCATGGAGGGGAAGTGGG No data
1129162990_1129163000 7 Left 1129162990 15:73757630-73757652 CCTGAAGCCAGAGGGTTGGGACC No data
Right 1129163000 15:73757660-73757682 CTGTGGCCATGGAGGGGAAGTGG No data
1129162990_1129163005 17 Left 1129162990 15:73757630-73757652 CCTGAAGCCAGAGGGTTGGGACC No data
Right 1129163005 15:73757670-73757692 GGAGGGGAAGTGGGGGCATTTGG No data
1129162990_1129162995 -1 Left 1129162990 15:73757630-73757652 CCTGAAGCCAGAGGGTTGGGACC No data
Right 1129162995 15:73757652-73757674 CTGCTGCCCTGTGGCCATGGAGG No data
1129162990_1129162997 1 Left 1129162990 15:73757630-73757652 CCTGAAGCCAGAGGGTTGGGACC No data
Right 1129162997 15:73757654-73757676 GCTGCCCTGTGGCCATGGAGGGG No data
1129162990_1129163002 9 Left 1129162990 15:73757630-73757652 CCTGAAGCCAGAGGGTTGGGACC No data
Right 1129163002 15:73757662-73757684 GTGGCCATGGAGGGGAAGTGGGG No data
1129162990_1129162996 0 Left 1129162990 15:73757630-73757652 CCTGAAGCCAGAGGGTTGGGACC No data
Right 1129162996 15:73757653-73757675 TGCTGCCCTGTGGCCATGGAGGG No data
1129162990_1129163003 10 Left 1129162990 15:73757630-73757652 CCTGAAGCCAGAGGGTTGGGACC No data
Right 1129163003 15:73757663-73757685 TGGCCATGGAGGGGAAGTGGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1129162990 Original CRISPR GGTCCCAACCCTCTGGCTTC AGG (reversed) Intergenic
No off target data available for this crispr