ID: 1129163000

View in Genome Browser
Species Human (GRCh38)
Location 15:73757660-73757682
Sequence CTGTGGCCATGGAGGGGAAG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1129162990_1129163000 7 Left 1129162990 15:73757630-73757652 CCTGAAGCCAGAGGGTTGGGACC No data
Right 1129163000 15:73757660-73757682 CTGTGGCCATGGAGGGGAAGTGG No data
1129162987_1129163000 13 Left 1129162987 15:73757624-73757646 CCAAATCCTGAAGCCAGAGGGTT No data
Right 1129163000 15:73757660-73757682 CTGTGGCCATGGAGGGGAAGTGG No data
1129162991_1129163000 0 Left 1129162991 15:73757637-73757659 CCAGAGGGTTGGGACCTGCTGCC No data
Right 1129163000 15:73757660-73757682 CTGTGGCCATGGAGGGGAAGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1129163000 Original CRISPR CTGTGGCCATGGAGGGGAAG TGG Intergenic
No off target data available for this crispr