ID: 1129165252

View in Genome Browser
Species Human (GRCh38)
Location 15:73773597-73773619
Sequence GTTCACAGCATTCCGAAGTA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1129165252_1129165260 26 Left 1129165252 15:73773597-73773619 CCTTACTTCGGAATGCTGTGAAC No data
Right 1129165260 15:73773646-73773668 GGGGGTAGGAGTGGGAGAAATGG No data
1129165252_1129165255 7 Left 1129165252 15:73773597-73773619 CCTTACTTCGGAATGCTGTGAAC No data
Right 1129165255 15:73773627-73773649 CGAATGATTGAGCTGTTTTGGGG No data
1129165252_1129165258 17 Left 1129165252 15:73773597-73773619 CCTTACTTCGGAATGCTGTGAAC No data
Right 1129165258 15:73773637-73773659 AGCTGTTTTGGGGGTAGGAGTGG No data
1129165252_1129165256 8 Left 1129165252 15:73773597-73773619 CCTTACTTCGGAATGCTGTGAAC No data
Right 1129165256 15:73773628-73773650 GAATGATTGAGCTGTTTTGGGGG No data
1129165252_1129165254 6 Left 1129165252 15:73773597-73773619 CCTTACTTCGGAATGCTGTGAAC No data
Right 1129165254 15:73773626-73773648 ACGAATGATTGAGCTGTTTTGGG No data
1129165252_1129165261 29 Left 1129165252 15:73773597-73773619 CCTTACTTCGGAATGCTGTGAAC No data
Right 1129165261 15:73773649-73773671 GGTAGGAGTGGGAGAAATGGAGG No data
1129165252_1129165259 18 Left 1129165252 15:73773597-73773619 CCTTACTTCGGAATGCTGTGAAC No data
Right 1129165259 15:73773638-73773660 GCTGTTTTGGGGGTAGGAGTGGG No data
1129165252_1129165257 12 Left 1129165252 15:73773597-73773619 CCTTACTTCGGAATGCTGTGAAC No data
Right 1129165257 15:73773632-73773654 GATTGAGCTGTTTTGGGGGTAGG No data
1129165252_1129165253 5 Left 1129165252 15:73773597-73773619 CCTTACTTCGGAATGCTGTGAAC No data
Right 1129165253 15:73773625-73773647 CACGAATGATTGAGCTGTTTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1129165252 Original CRISPR GTTCACAGCATTCCGAAGTA AGG (reversed) Intergenic
No off target data available for this crispr