ID: 1129167019

View in Genome Browser
Species Human (GRCh38)
Location 15:73784473-73784495
Sequence GAGAGCTCTCATCAGGCCCG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1129167019_1129167024 9 Left 1129167019 15:73784473-73784495 CCTCGGGCCTGATGAGAGCTCTC No data
Right 1129167024 15:73784505-73784527 CTTCCTTGCCAGCTAGGCCTTGG No data
1129167019_1129167026 11 Left 1129167019 15:73784473-73784495 CCTCGGGCCTGATGAGAGCTCTC No data
Right 1129167026 15:73784507-73784529 TCCTTGCCAGCTAGGCCTTGGGG No data
1129167019_1129167021 3 Left 1129167019 15:73784473-73784495 CCTCGGGCCTGATGAGAGCTCTC No data
Right 1129167021 15:73784499-73784521 ACCTTCCTTCCTTGCCAGCTAGG No data
1129167019_1129167025 10 Left 1129167019 15:73784473-73784495 CCTCGGGCCTGATGAGAGCTCTC No data
Right 1129167025 15:73784506-73784528 TTCCTTGCCAGCTAGGCCTTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1129167019 Original CRISPR GAGAGCTCTCATCAGGCCCG AGG (reversed) Intergenic
No off target data available for this crispr