ID: 1129169971

View in Genome Browser
Species Human (GRCh38)
Location 15:73801658-73801680
Sequence TGTACCCAAGTCCTGGCCCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1129169971_1129169982 29 Left 1129169971 15:73801658-73801680 CCTGGGGCCAGGACTTGGGTACA No data
Right 1129169982 15:73801710-73801732 GGTAGCTGGGTAGTGAGACAGGG No data
1129169971_1129169978 8 Left 1129169971 15:73801658-73801680 CCTGGGGCCAGGACTTGGGTACA No data
Right 1129169978 15:73801689-73801711 ATTGGGAGATTTCAGGAAGAGGG No data
1129169971_1129169979 15 Left 1129169971 15:73801658-73801680 CCTGGGGCCAGGACTTGGGTACA No data
Right 1129169979 15:73801696-73801718 GATTTCAGGAAGAGGGTAGCTGG No data
1129169971_1129169974 -10 Left 1129169971 15:73801658-73801680 CCTGGGGCCAGGACTTGGGTACA No data
Right 1129169974 15:73801671-73801693 CTTGGGTACAGGAAGTGTATTGG No data
1129169971_1129169981 28 Left 1129169971 15:73801658-73801680 CCTGGGGCCAGGACTTGGGTACA No data
Right 1129169981 15:73801709-73801731 GGGTAGCTGGGTAGTGAGACAGG No data
1129169971_1129169975 -9 Left 1129169971 15:73801658-73801680 CCTGGGGCCAGGACTTGGGTACA No data
Right 1129169975 15:73801672-73801694 TTGGGTACAGGAAGTGTATTGGG No data
1129169971_1129169980 16 Left 1129169971 15:73801658-73801680 CCTGGGGCCAGGACTTGGGTACA No data
Right 1129169980 15:73801697-73801719 ATTTCAGGAAGAGGGTAGCTGGG No data
1129169971_1129169977 7 Left 1129169971 15:73801658-73801680 CCTGGGGCCAGGACTTGGGTACA No data
Right 1129169977 15:73801688-73801710 TATTGGGAGATTTCAGGAAGAGG No data
1129169971_1129169976 1 Left 1129169971 15:73801658-73801680 CCTGGGGCCAGGACTTGGGTACA No data
Right 1129169976 15:73801682-73801704 GAAGTGTATTGGGAGATTTCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1129169971 Original CRISPR TGTACCCAAGTCCTGGCCCC AGG (reversed) Intergenic