ID: 1129169973

View in Genome Browser
Species Human (GRCh38)
Location 15:73801665-73801687
Sequence CACTTCCTGTACCCAAGTCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1129169973_1129169983 26 Left 1129169973 15:73801665-73801687 CCAGGACTTGGGTACAGGAAGTG No data
Right 1129169983 15:73801714-73801736 GCTGGGTAGTGAGACAGGGAAGG No data
1129169973_1129169979 8 Left 1129169973 15:73801665-73801687 CCAGGACTTGGGTACAGGAAGTG No data
Right 1129169979 15:73801696-73801718 GATTTCAGGAAGAGGGTAGCTGG No data
1129169973_1129169984 29 Left 1129169973 15:73801665-73801687 CCAGGACTTGGGTACAGGAAGTG No data
Right 1129169984 15:73801717-73801739 GGGTAGTGAGACAGGGAAGGAGG No data
1129169973_1129169981 21 Left 1129169973 15:73801665-73801687 CCAGGACTTGGGTACAGGAAGTG No data
Right 1129169981 15:73801709-73801731 GGGTAGCTGGGTAGTGAGACAGG No data
1129169973_1129169980 9 Left 1129169973 15:73801665-73801687 CCAGGACTTGGGTACAGGAAGTG No data
Right 1129169980 15:73801697-73801719 ATTTCAGGAAGAGGGTAGCTGGG No data
1129169973_1129169976 -6 Left 1129169973 15:73801665-73801687 CCAGGACTTGGGTACAGGAAGTG No data
Right 1129169976 15:73801682-73801704 GAAGTGTATTGGGAGATTTCAGG No data
1129169973_1129169978 1 Left 1129169973 15:73801665-73801687 CCAGGACTTGGGTACAGGAAGTG No data
Right 1129169978 15:73801689-73801711 ATTGGGAGATTTCAGGAAGAGGG No data
1129169973_1129169977 0 Left 1129169973 15:73801665-73801687 CCAGGACTTGGGTACAGGAAGTG No data
Right 1129169977 15:73801688-73801710 TATTGGGAGATTTCAGGAAGAGG No data
1129169973_1129169982 22 Left 1129169973 15:73801665-73801687 CCAGGACTTGGGTACAGGAAGTG No data
Right 1129169982 15:73801710-73801732 GGTAGCTGGGTAGTGAGACAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1129169973 Original CRISPR CACTTCCTGTACCCAAGTCC TGG (reversed) Intergenic