ID: 1129169981

View in Genome Browser
Species Human (GRCh38)
Location 15:73801709-73801731
Sequence GGGTAGCTGGGTAGTGAGAC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1129169971_1129169981 28 Left 1129169971 15:73801658-73801680 CCTGGGGCCAGGACTTGGGTACA No data
Right 1129169981 15:73801709-73801731 GGGTAGCTGGGTAGTGAGACAGG No data
1129169973_1129169981 21 Left 1129169973 15:73801665-73801687 CCAGGACTTGGGTACAGGAAGTG No data
Right 1129169981 15:73801709-73801731 GGGTAGCTGGGTAGTGAGACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1129169981 Original CRISPR GGGTAGCTGGGTAGTGAGAC AGG Intergenic
No off target data available for this crispr