ID: 1129169982 |
View in Genome Browser |
Species | Human (GRCh38) |
Location | 15:73801710-73801732 |
Sequence | GGTAGCTGGGTAGTGAGACA GGG |
Strand | + |
Crispr in exon? | No |
Crispr in intron? | No |
Off-Target Counts | All | Exonic | Intronic | Intergenic |
---|---|---|---|---|
Total | ||||
Summary |
Found 2 Related Crispr Pairs
Show Crispr PairsID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
---|---|---|---|---|---|---|---|---|
1129169971_1129169982 | 29 | Left | 1129169971 | 15:73801658-73801680 | CCTGGGGCCAGGACTTGGGTACA | No data | ||
Right | 1129169982 | 15:73801710-73801732 | GGTAGCTGGGTAGTGAGACAGGG | No data | ||||
1129169973_1129169982 | 22 | Left | 1129169973 | 15:73801665-73801687 | CCAGGACTTGGGTACAGGAAGTG | No data | ||
Right | 1129169982 | 15:73801710-73801732 | GGTAGCTGGGTAGTGAGACAGGG | No data |
Note: the row highlighted in blue is the original CRISPR
WGE ID | Location | Sequence | Mismatches | Strand | Type |
---|---|---|---|---|---|
1129169982 | Original CRISPR | GGTAGCTGGGTAGTGAGACA GGG | Intergenic | ||