ID: 1129171340

View in Genome Browser
Species Human (GRCh38)
Location 15:73810014-73810036
Sequence CAGACTCAGGAGAGGGAGGA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1129171335_1129171340 0 Left 1129171335 15:73809991-73810013 CCTGGGCACTAACTCAGCTGAGA No data
Right 1129171340 15:73810014-73810036 CAGACTCAGGAGAGGGAGGAAGG No data
1129171325_1129171340 26 Left 1129171325 15:73809965-73809987 CCTCTGCCAGCCCAGCCACCCAC No data
Right 1129171340 15:73810014-73810036 CAGACTCAGGAGAGGGAGGAAGG No data
1129171331_1129171340 11 Left 1129171331 15:73809980-73810002 CCACCCACAGCCCTGGGCACTAA No data
Right 1129171340 15:73810014-73810036 CAGACTCAGGAGAGGGAGGAAGG No data
1129171326_1129171340 20 Left 1129171326 15:73809971-73809993 CCAGCCCAGCCACCCACAGCCCT No data
Right 1129171340 15:73810014-73810036 CAGACTCAGGAGAGGGAGGAAGG No data
1129171324_1129171340 27 Left 1129171324 15:73809964-73809986 CCCTCTGCCAGCCCAGCCACCCA No data
Right 1129171340 15:73810014-73810036 CAGACTCAGGAGAGGGAGGAAGG No data
1129171329_1129171340 16 Left 1129171329 15:73809975-73809997 CCCAGCCACCCACAGCCCTGGGC No data
Right 1129171340 15:73810014-73810036 CAGACTCAGGAGAGGGAGGAAGG No data
1129171333_1129171340 7 Left 1129171333 15:73809984-73810006 CCACAGCCCTGGGCACTAACTCA No data
Right 1129171340 15:73810014-73810036 CAGACTCAGGAGAGGGAGGAAGG No data
1129171332_1129171340 8 Left 1129171332 15:73809983-73810005 CCCACAGCCCTGGGCACTAACTC No data
Right 1129171340 15:73810014-73810036 CAGACTCAGGAGAGGGAGGAAGG No data
1129171330_1129171340 15 Left 1129171330 15:73809976-73809998 CCAGCCACCCACAGCCCTGGGCA No data
Right 1129171340 15:73810014-73810036 CAGACTCAGGAGAGGGAGGAAGG No data
1129171334_1129171340 1 Left 1129171334 15:73809990-73810012 CCCTGGGCACTAACTCAGCTGAG No data
Right 1129171340 15:73810014-73810036 CAGACTCAGGAGAGGGAGGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1129171340 Original CRISPR CAGACTCAGGAGAGGGAGGA AGG Intergenic
No off target data available for this crispr