ID: 1129171736

View in Genome Browser
Species Human (GRCh38)
Location 15:73812172-73812194
Sequence CCTGTCAGGCTTAGAGCTTC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1129171736_1129171740 -5 Left 1129171736 15:73812172-73812194 CCTGAAGCTCTAAGCCTGACAGG No data
Right 1129171740 15:73812190-73812212 ACAGGGAGACAGACCTCAGACGG No data
1129171736_1129171744 19 Left 1129171736 15:73812172-73812194 CCTGAAGCTCTAAGCCTGACAGG No data
Right 1129171744 15:73812214-73812236 GAGCACACACCATAGCAGAATGG No data
1129171736_1129171742 -3 Left 1129171736 15:73812172-73812194 CCTGAAGCTCTAAGCCTGACAGG No data
Right 1129171742 15:73812192-73812214 AGGGAGACAGACCTCAGACGGGG No data
1129171736_1129171745 26 Left 1129171736 15:73812172-73812194 CCTGAAGCTCTAAGCCTGACAGG No data
Right 1129171745 15:73812221-73812243 CACCATAGCAGAATGGAGCCTGG No data
1129171736_1129171741 -4 Left 1129171736 15:73812172-73812194 CCTGAAGCTCTAAGCCTGACAGG No data
Right 1129171741 15:73812191-73812213 CAGGGAGACAGACCTCAGACGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1129171736 Original CRISPR CCTGTCAGGCTTAGAGCTTC AGG (reversed) Intergenic
No off target data available for this crispr