ID: 1129171739

View in Genome Browser
Species Human (GRCh38)
Location 15:73812186-73812208
Sequence CTGAGGTCTGTCTCCCTGTC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1129171739_1129171747 21 Left 1129171739 15:73812186-73812208 CCTGACAGGGAGACAGACCTCAG No data
Right 1129171747 15:73812230-73812252 AGAATGGAGCCTGGACAGTGTGG No data
1129171739_1129171748 24 Left 1129171739 15:73812186-73812208 CCTGACAGGGAGACAGACCTCAG No data
Right 1129171748 15:73812233-73812255 ATGGAGCCTGGACAGTGTGGAGG No data
1129171739_1129171745 12 Left 1129171739 15:73812186-73812208 CCTGACAGGGAGACAGACCTCAG No data
Right 1129171745 15:73812221-73812243 CACCATAGCAGAATGGAGCCTGG No data
1129171739_1129171744 5 Left 1129171739 15:73812186-73812208 CCTGACAGGGAGACAGACCTCAG No data
Right 1129171744 15:73812214-73812236 GAGCACACACCATAGCAGAATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1129171739 Original CRISPR CTGAGGTCTGTCTCCCTGTC AGG (reversed) Intergenic
No off target data available for this crispr