ID: 1129171742

View in Genome Browser
Species Human (GRCh38)
Location 15:73812192-73812214
Sequence AGGGAGACAGACCTCAGACG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1129171736_1129171742 -3 Left 1129171736 15:73812172-73812194 CCTGAAGCTCTAAGCCTGACAGG No data
Right 1129171742 15:73812192-73812214 AGGGAGACAGACCTCAGACGGGG No data
1129171734_1129171742 -1 Left 1129171734 15:73812170-73812192 CCCCTGAAGCTCTAAGCCTGACA No data
Right 1129171742 15:73812192-73812214 AGGGAGACAGACCTCAGACGGGG No data
1129171735_1129171742 -2 Left 1129171735 15:73812171-73812193 CCCTGAAGCTCTAAGCCTGACAG No data
Right 1129171742 15:73812192-73812214 AGGGAGACAGACCTCAGACGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1129171742 Original CRISPR AGGGAGACAGACCTCAGACG GGG Intergenic
No off target data available for this crispr