ID: 1129171745

View in Genome Browser
Species Human (GRCh38)
Location 15:73812221-73812243
Sequence CACCATAGCAGAATGGAGCC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1129171743_1129171745 -5 Left 1129171743 15:73812203-73812225 CCTCAGACGGGGAGCACACACCA No data
Right 1129171745 15:73812221-73812243 CACCATAGCAGAATGGAGCCTGG No data
1129171736_1129171745 26 Left 1129171736 15:73812172-73812194 CCTGAAGCTCTAAGCCTGACAGG No data
Right 1129171745 15:73812221-73812243 CACCATAGCAGAATGGAGCCTGG No data
1129171735_1129171745 27 Left 1129171735 15:73812171-73812193 CCCTGAAGCTCTAAGCCTGACAG No data
Right 1129171745 15:73812221-73812243 CACCATAGCAGAATGGAGCCTGG No data
1129171739_1129171745 12 Left 1129171739 15:73812186-73812208 CCTGACAGGGAGACAGACCTCAG No data
Right 1129171745 15:73812221-73812243 CACCATAGCAGAATGGAGCCTGG No data
1129171734_1129171745 28 Left 1129171734 15:73812170-73812192 CCCCTGAAGCTCTAAGCCTGACA No data
Right 1129171745 15:73812221-73812243 CACCATAGCAGAATGGAGCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1129171745 Original CRISPR CACCATAGCAGAATGGAGCC TGG Intergenic
No off target data available for this crispr