ID: 1129171747

View in Genome Browser
Species Human (GRCh38)
Location 15:73812230-73812252
Sequence AGAATGGAGCCTGGACAGTG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1129171739_1129171747 21 Left 1129171739 15:73812186-73812208 CCTGACAGGGAGACAGACCTCAG No data
Right 1129171747 15:73812230-73812252 AGAATGGAGCCTGGACAGTGTGG No data
1129171743_1129171747 4 Left 1129171743 15:73812203-73812225 CCTCAGACGGGGAGCACACACCA No data
Right 1129171747 15:73812230-73812252 AGAATGGAGCCTGGACAGTGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1129171747 Original CRISPR AGAATGGAGCCTGGACAGTG TGG Intergenic
No off target data available for this crispr