ID: 1129171748

View in Genome Browser
Species Human (GRCh38)
Location 15:73812233-73812255
Sequence ATGGAGCCTGGACAGTGTGG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1129171743_1129171748 7 Left 1129171743 15:73812203-73812225 CCTCAGACGGGGAGCACACACCA No data
Right 1129171748 15:73812233-73812255 ATGGAGCCTGGACAGTGTGGAGG No data
1129171739_1129171748 24 Left 1129171739 15:73812186-73812208 CCTGACAGGGAGACAGACCTCAG No data
Right 1129171748 15:73812233-73812255 ATGGAGCCTGGACAGTGTGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1129171748 Original CRISPR ATGGAGCCTGGACAGTGTGG AGG Intergenic
No off target data available for this crispr