ID: 1129171964

View in Genome Browser
Species Human (GRCh38)
Location 15:73813436-73813458
Sequence TTGTCATGAGCAGAAGACAG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1129171964_1129171966 20 Left 1129171964 15:73813436-73813458 CCTCTGTCTTCTGCTCATGACAA No data
Right 1129171966 15:73813479-73813501 TGAGGAGTTTTAAGATTCTGAGG No data
1129171964_1129171967 24 Left 1129171964 15:73813436-73813458 CCTCTGTCTTCTGCTCATGACAA No data
Right 1129171967 15:73813483-73813505 GAGTTTTAAGATTCTGAGGCTGG No data
1129171964_1129171965 2 Left 1129171964 15:73813436-73813458 CCTCTGTCTTCTGCTCATGACAA No data
Right 1129171965 15:73813461-73813483 GCTAATCTACAGCAAAGCTGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1129171964 Original CRISPR TTGTCATGAGCAGAAGACAG AGG (reversed) Intergenic