ID: 1129174853

View in Genome Browser
Species Human (GRCh38)
Location 15:73832585-73832607
Sequence GGCCAGGGGGACGGCAGTGA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1129174844_1129174853 1 Left 1129174844 15:73832561-73832583 CCTCAGTCTCCTGAAGCAGGGCT No data
Right 1129174853 15:73832585-73832607 GGCCAGGGGGACGGCAGTGAGGG No data
1129174843_1129174853 2 Left 1129174843 15:73832560-73832582 CCCTCAGTCTCCTGAAGCAGGGC No data
Right 1129174853 15:73832585-73832607 GGCCAGGGGGACGGCAGTGAGGG No data
1129174838_1129174853 23 Left 1129174838 15:73832539-73832561 CCTCAAAGGAAGAGGAGAACCCC No data
Right 1129174853 15:73832585-73832607 GGCCAGGGGGACGGCAGTGAGGG No data
1129174847_1129174853 -8 Left 1129174847 15:73832570-73832592 CCTGAAGCAGGGCTAGGCCAGGG No data
Right 1129174853 15:73832585-73832607 GGCCAGGGGGACGGCAGTGAGGG No data
1129174839_1129174853 4 Left 1129174839 15:73832558-73832580 CCCCCTCAGTCTCCTGAAGCAGG No data
Right 1129174853 15:73832585-73832607 GGCCAGGGGGACGGCAGTGAGGG No data
1129174841_1129174853 3 Left 1129174841 15:73832559-73832581 CCCCTCAGTCTCCTGAAGCAGGG No data
Right 1129174853 15:73832585-73832607 GGCCAGGGGGACGGCAGTGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1129174853 Original CRISPR GGCCAGGGGGACGGCAGTGA GGG Intergenic
No off target data available for this crispr