ID: 1129177389

View in Genome Browser
Species Human (GRCh38)
Location 15:73849710-73849732
Sequence GGTTCCTTTTCCAGAGGGCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1129177389_1129177394 5 Left 1129177389 15:73849710-73849732 CCAGGCCCTCTGGAAAAGGAACC No data
Right 1129177394 15:73849738-73849760 GCAGCCCCCACCCAGGTAGCTGG No data
1129177389_1129177393 -2 Left 1129177389 15:73849710-73849732 CCAGGCCCTCTGGAAAAGGAACC No data
Right 1129177393 15:73849731-73849753 CCGCTAAGCAGCCCCCACCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1129177389 Original CRISPR GGTTCCTTTTCCAGAGGGCC TGG (reversed) Intergenic