ID: 1129177389 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 15:73849710-73849732 |
| Sequence | GGTTCCTTTTCCAGAGGGCC TGG (reversed) |
| Strand | - |
| Crispr in exon? | No |
| Crispr in intron? | No |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | ||||
| Summary |
Found 2 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 1129177389_1129177394 | 5 | Left | 1129177389 | 15:73849710-73849732 | CCAGGCCCTCTGGAAAAGGAACC | No data | ||
| Right | 1129177394 | 15:73849738-73849760 | GCAGCCCCCACCCAGGTAGCTGG | No data | ||||
| 1129177389_1129177393 | -2 | Left | 1129177389 | 15:73849710-73849732 | CCAGGCCCTCTGGAAAAGGAACC | No data | ||
| Right | 1129177393 | 15:73849731-73849753 | CCGCTAAGCAGCCCCCACCCAGG | No data |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 1129177389 | Original CRISPR | GGTTCCTTTTCCAGAGGGCC TGG (reversed) | Intergenic | ||