ID: 1129177413

View in Genome Browser
Species Human (GRCh38)
Location 15:73849814-73849836
Sequence GTGCAGAAGAAGGCTCAGCC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1129177405_1129177413 11 Left 1129177405 15:73849780-73849802 CCCTGCCCAGTCACAAGCCTGAG No data
Right 1129177413 15:73849814-73849836 GTGCAGAAGAAGGCTCAGCCTGG No data
1129177404_1129177413 15 Left 1129177404 15:73849776-73849798 CCAGCCCTGCCCAGTCACAAGCC No data
Right 1129177413 15:73849814-73849836 GTGCAGAAGAAGGCTCAGCCTGG No data
1129177406_1129177413 10 Left 1129177406 15:73849781-73849803 CCTGCCCAGTCACAAGCCTGAGA No data
Right 1129177413 15:73849814-73849836 GTGCAGAAGAAGGCTCAGCCTGG No data
1129177410_1129177413 -6 Left 1129177410 15:73849797-73849819 CCTGAGAATGAGTCCAGGTGCAG No data
Right 1129177413 15:73849814-73849836 GTGCAGAAGAAGGCTCAGCCTGG No data
1129177402_1129177413 17 Left 1129177402 15:73849774-73849796 CCCCAGCCCTGCCCAGTCACAAG No data
Right 1129177413 15:73849814-73849836 GTGCAGAAGAAGGCTCAGCCTGG No data
1129177407_1129177413 6 Left 1129177407 15:73849785-73849807 CCCAGTCACAAGCCTGAGAATGA No data
Right 1129177413 15:73849814-73849836 GTGCAGAAGAAGGCTCAGCCTGG No data
1129177403_1129177413 16 Left 1129177403 15:73849775-73849797 CCCAGCCCTGCCCAGTCACAAGC No data
Right 1129177413 15:73849814-73849836 GTGCAGAAGAAGGCTCAGCCTGG No data
1129177401_1129177413 21 Left 1129177401 15:73849770-73849792 CCTTCCCCAGCCCTGCCCAGTCA No data
Right 1129177413 15:73849814-73849836 GTGCAGAAGAAGGCTCAGCCTGG No data
1129177408_1129177413 5 Left 1129177408 15:73849786-73849808 CCAGTCACAAGCCTGAGAATGAG No data
Right 1129177413 15:73849814-73849836 GTGCAGAAGAAGGCTCAGCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1129177413 Original CRISPR GTGCAGAAGAAGGCTCAGCC TGG Intergenic
No off target data available for this crispr