ID: 1129178332

View in Genome Browser
Species Human (GRCh38)
Location 15:73855959-73855981
Sequence CAGCCAGCAGGTACCATGGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1129178332_1129178339 14 Left 1129178332 15:73855959-73855981 CCCACCATGGTACCTGCTGGCTG No data
Right 1129178339 15:73855996-73856018 GTGCTCTTTGACACTGAGTGTGG No data
1129178332_1129178341 21 Left 1129178332 15:73855959-73855981 CCCACCATGGTACCTGCTGGCTG No data
Right 1129178341 15:73856003-73856025 TTGACACTGAGTGTGGAGTAGGG No data
1129178332_1129178342 22 Left 1129178332 15:73855959-73855981 CCCACCATGGTACCTGCTGGCTG No data
Right 1129178342 15:73856004-73856026 TGACACTGAGTGTGGAGTAGGGG No data
1129178332_1129178340 20 Left 1129178332 15:73855959-73855981 CCCACCATGGTACCTGCTGGCTG No data
Right 1129178340 15:73856002-73856024 TTTGACACTGAGTGTGGAGTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1129178332 Original CRISPR CAGCCAGCAGGTACCATGGT GGG (reversed) Intergenic
No off target data available for this crispr