ID: 1129178710

View in Genome Browser
Species Human (GRCh38)
Location 15:73858093-73858115
Sequence GCAGACACCCGAGCCAAAGC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1129178709_1129178710 -4 Left 1129178709 15:73858074-73858096 CCTATCTGGGGATGTGAGTGCAG No data
Right 1129178710 15:73858093-73858115 GCAGACACCCGAGCCAAAGCTGG No data
1129178704_1129178710 29 Left 1129178704 15:73858041-73858063 CCTTTGAGCTAGGTTCCAGAGGC No data
Right 1129178710 15:73858093-73858115 GCAGACACCCGAGCCAAAGCTGG No data
1129178705_1129178710 14 Left 1129178705 15:73858056-73858078 CCAGAGGCATGCTCTGCACCTAT No data
Right 1129178710 15:73858093-73858115 GCAGACACCCGAGCCAAAGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1129178710 Original CRISPR GCAGACACCCGAGCCAAAGC TGG Intergenic
No off target data available for this crispr