ID: 1129179591

View in Genome Browser
Species Human (GRCh38)
Location 15:73865601-73865623
Sequence ATGTAACCCTGCAATAATGG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1129179582_1129179591 17 Left 1129179582 15:73865561-73865583 CCTATCTCTACCATCAGACAGGG No data
Right 1129179591 15:73865601-73865623 ATGTAACCCTGCAATAATGGGGG No data
1129179585_1129179591 7 Left 1129179585 15:73865571-73865593 CCATCAGACAGGGGCTTTCAGAC No data
Right 1129179591 15:73865601-73865623 ATGTAACCCTGCAATAATGGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1129179591 Original CRISPR ATGTAACCCTGCAATAATGG GGG Intergenic
No off target data available for this crispr