ID: 1129180251

View in Genome Browser
Species Human (GRCh38)
Location 15:73869729-73869751
Sequence GTCCGAGCTACCTGCTTTGG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1129180249_1129180251 -9 Left 1129180249 15:73869715-73869737 CCTGGGCTTGGTGAGTCCGAGCT No data
Right 1129180251 15:73869729-73869751 GTCCGAGCTACCTGCTTTGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1129180251 Original CRISPR GTCCGAGCTACCTGCTTTGG TGG Intergenic
No off target data available for this crispr