ID: 1129180707

View in Genome Browser
Species Human (GRCh38)
Location 15:73873161-73873183
Sequence TACCCAAGACATCTGAAGCC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1129180699_1129180707 25 Left 1129180699 15:73873113-73873135 CCCCCAGGCCCCAGCACTGACAT No data
Right 1129180707 15:73873161-73873183 TACCCAAGACATCTGAAGCCTGG No data
1129180702_1129180707 22 Left 1129180702 15:73873116-73873138 CCAGGCCCCAGCACTGACATACT No data
Right 1129180707 15:73873161-73873183 TACCCAAGACATCTGAAGCCTGG No data
1129180698_1129180707 26 Left 1129180698 15:73873112-73873134 CCCCCCAGGCCCCAGCACTGACA No data
Right 1129180707 15:73873161-73873183 TACCCAAGACATCTGAAGCCTGG No data
1129180703_1129180707 17 Left 1129180703 15:73873121-73873143 CCCCAGCACTGACATACTGATTC No data
Right 1129180707 15:73873161-73873183 TACCCAAGACATCTGAAGCCTGG No data
1129180701_1129180707 23 Left 1129180701 15:73873115-73873137 CCCAGGCCCCAGCACTGACATAC No data
Right 1129180707 15:73873161-73873183 TACCCAAGACATCTGAAGCCTGG No data
1129180705_1129180707 15 Left 1129180705 15:73873123-73873145 CCAGCACTGACATACTGATTCTG No data
Right 1129180707 15:73873161-73873183 TACCCAAGACATCTGAAGCCTGG No data
1129180700_1129180707 24 Left 1129180700 15:73873114-73873136 CCCCAGGCCCCAGCACTGACATA No data
Right 1129180707 15:73873161-73873183 TACCCAAGACATCTGAAGCCTGG No data
1129180704_1129180707 16 Left 1129180704 15:73873122-73873144 CCCAGCACTGACATACTGATTCT No data
Right 1129180707 15:73873161-73873183 TACCCAAGACATCTGAAGCCTGG No data
1129180697_1129180707 30 Left 1129180697 15:73873108-73873130 CCAGCCCCCCAGGCCCCAGCACT No data
Right 1129180707 15:73873161-73873183 TACCCAAGACATCTGAAGCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1129180707 Original CRISPR TACCCAAGACATCTGAAGCC TGG Intergenic
No off target data available for this crispr