ID: 1129181802

View in Genome Browser
Species Human (GRCh38)
Location 15:73882413-73882435
Sequence AAGGGTGAACCAAGGACAGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 319
Summary {0: 1, 1: 0, 2: 3, 3: 17, 4: 298}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1129181802_1129181807 -4 Left 1129181802 15:73882413-73882435 CCCTCTGTCCTTGGTTCACCCTT 0: 1
1: 0
2: 3
3: 17
4: 298
Right 1129181807 15:73882432-73882454 CCTTTCTCCTCCCTCCACAATGG 0: 1
1: 0
2: 3
3: 49
4: 407

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1129181802 Original CRISPR AAGGGTGAACCAAGGACAGA GGG (reversed) Intronic
900150574 1:1177605-1177627 AAGAGTGACACAAGGACAGCCGG - Intronic
901401075 1:9015326-9015348 ATGTGTGAACCAAGGACTGTGGG + Intronic
901410206 1:9077727-9077749 AAGGGTGAAACAGGGAGAGAGGG + Intronic
901920074 1:12529709-12529731 AAGGGTGGACCCAGGAAGGATGG - Intergenic
902265436 1:15260126-15260148 ATGGGTGGACAAAGAACAGAAGG + Intronic
902663233 1:17920062-17920084 ATGGGTGGACACAGGACAGAGGG - Intergenic
903666561 1:25011510-25011532 AAGGGAGAACCAGGGACAGAGGG - Intergenic
903702799 1:25263202-25263224 AAGGGTGGGCCAGGGAGAGACGG + Intronic
903712063 1:25333528-25333550 AAGGGTGGGCCAGGGAGAGACGG + Intronic
903768253 1:25748483-25748505 CAGGGTGAACACAGGACACAGGG - Intronic
905337585 1:37256133-37256155 AAGGAAGAGCCAAGGAAAGAAGG - Intergenic
906421213 1:45669008-45669030 AATGGTGTATCAATGACAGATGG - Intronic
906483530 1:46217197-46217219 AATTGTGCAGCAAGGACAGATGG + Intronic
906702250 1:47868344-47868366 AAGGAGGAAGGAAGGACAGAAGG + Intronic
907722075 1:56981438-56981460 GAGGGAGAAGGAAGGACAGATGG - Intergenic
908851306 1:68379324-68379346 AAGGCTGAACCAAGAACCCAGGG + Intergenic
909350238 1:74644133-74644155 AGGAGGGAACCAAGAACAGAGGG - Intronic
910117515 1:83748686-83748708 ACAGGAGAACCAAGGACTGATGG + Intergenic
910716698 1:90239235-90239257 AAGGAGGAACAAAGAACAGAGGG - Intergenic
910746157 1:90577069-90577091 ATTGGTGAGCCATGGACAGAAGG - Intergenic
912929033 1:113939663-113939685 AAGGGTAGAGCAAGGAAAGAGGG + Intronic
913664638 1:121036054-121036076 AAGGGTGACCCAAGGAGCGCTGG - Intergenic
914016029 1:143819329-143819351 AAGGGTGACCCAAGGAGTGCTGG - Intergenic
914161753 1:145141679-145141701 AAGGGTGACCCAAGGAGTGCTGG + Intergenic
914654648 1:149727870-149727892 AAGGGTGACCCAAGGAGTGCTGG - Intergenic
916778504 1:167996193-167996215 AAGAATGAACCAAAGAAAGAAGG - Intronic
917081825 1:171263608-171263630 AGGGTTGAACCATGGAAAGAGGG - Intronic
918412961 1:184279776-184279798 AACAGTGAACCAAGGAAAAAGGG - Intergenic
919582144 1:199389581-199389603 CAGCCTGACCCAAGGACAGATGG - Intergenic
919980611 1:202640638-202640660 AAGGGAGAACCAAGGAAAACTGG + Intronic
920817210 1:209345898-209345920 AAAGGAGAAGCAAGGACGGAGGG - Intergenic
921523433 1:216186754-216186776 AAAGATGAACAAAGAACAGATGG - Intronic
923045446 1:230352407-230352429 AAAGGTCTTCCAAGGACAGAAGG + Intronic
923127849 1:231047664-231047686 AAGGGAGAAAGAAGGAAAGAGGG - Intergenic
924027075 1:239844932-239844954 CAGTGTGAACTAAGGAAAGAGGG + Intronic
924436012 1:244043437-244043459 AAGAGTGAAGCAAGCACAAAAGG + Intergenic
924603320 1:245510618-245510640 AGGGGTGAAACAGGGAGAGAGGG - Intronic
1063886545 10:10585375-10585397 AAAGGTGTACAGAGGACAGAAGG - Intergenic
1063967849 10:11360616-11360638 AAGGAAGATCCAAGGACAGAGGG + Intergenic
1064273465 10:13885720-13885742 AGGGGAGAACCATGTACAGAAGG - Intronic
1064414472 10:15136473-15136495 AAGGAGGAAGGAAGGACAGATGG + Intronic
1064479630 10:15726269-15726291 AAGGGAGAAGGAAGGAAAGATGG + Intergenic
1065182892 10:23144723-23144745 AAGATTGAACCAGGGACAGTGGG - Intergenic
1068163907 10:53303602-53303624 AAGAGGGAACAAAGGACAGCAGG + Intergenic
1068951389 10:62781027-62781049 ATGGGTTAACAAAGAACAGAAGG + Intergenic
1069668731 10:70183564-70183586 AAGGGAGAAGGAAGGAAAGAAGG + Intergenic
1071527979 10:86369008-86369030 AAGGAGGCACCCAGGACAGAAGG - Intergenic
1072193744 10:93097251-93097273 CCGGCTGACCCAAGGACAGAAGG - Intergenic
1072680500 10:97502685-97502707 AAGGCAGAACTAAGGACAAAGGG - Intronic
1076337968 10:129721861-129721883 AAGGGGGAACAAAGAACAGATGG + Intronic
1076444974 10:130508048-130508070 AAGGGTGCAGAAAAGACAGATGG - Intergenic
1076663337 10:132069720-132069742 AAGAGGAAACCATGGACAGAAGG + Intergenic
1077443110 11:2577881-2577903 AAGGGGGAGCCGTGGACAGAGGG - Intronic
1079474058 11:20809516-20809538 AAAGGAGAAGCAAGGAGAGAGGG - Intronic
1080387638 11:31819173-31819195 AAGGGAGAGCCGAGCACAGATGG + Intronic
1080678515 11:34450707-34450729 AAGGTTGGCCCAAGGACACAGGG - Intronic
1081564903 11:44253089-44253111 AAGAGTAAACAAAGGACAAAAGG + Intergenic
1081662232 11:44895216-44895238 AGGGGAGAACCATGGACACATGG - Intronic
1082788661 11:57332082-57332104 AAGGGTTTACCAAGGAGACACGG + Intronic
1082927452 11:58564998-58565020 CAGAGTGAACCAAGGACACAGGG + Intronic
1084130176 11:67127624-67127646 AAAGGTAAACCAAGGAAAGGTGG - Intronic
1085083783 11:73653458-73653480 AGAGGTGAACCAAGGAGATATGG + Intronic
1085752929 11:79177794-79177816 AAAGGTGACCCAAGGACTGAGGG + Intronic
1085943988 11:81243803-81243825 AAGGGTCAAACAAGAACTGAGGG - Intergenic
1087528334 11:99347309-99347331 AAGGGTAAAACAATGACACAGGG + Intronic
1087570147 11:99916878-99916900 AAGGAAGAACCAAGGAATGAAGG + Intronic
1087939550 11:104078493-104078515 AAGCCTGAATCAAGGAAAGAGGG - Intronic
1088194016 11:107256336-107256358 AAGGCTTAACCAAGGACCCATGG + Intergenic
1088403454 11:109446000-109446022 AAAGGTGAACCAAGGACTTTGGG - Intergenic
1089115135 11:116088734-116088756 AATGGTGAACCAAATAAAGATGG - Intergenic
1089454591 11:118618589-118618611 AGGGGTGAACTCAGGACTGATGG + Intronic
1090969163 11:131624761-131624783 AAGCATGAACCAAAGATAGAGGG - Intronic
1091112697 11:132984951-132984973 ACGGGGGAACAAAGGACAGGAGG - Intronic
1091584405 12:1807817-1807839 AAGGGTGAGCCAAGCACGGCGGG + Intronic
1091848785 12:3678606-3678628 AAGGCTGAGCCAAGGACTGGGGG + Intronic
1092363902 12:7861144-7861166 AAGGAAGAACCAAAGAGAGAGGG + Intronic
1092983499 12:13821301-13821323 AAGGTGGATCCCAGGACAGAGGG + Intronic
1094169975 12:27480976-27480998 AAGGCTGCCCCAAGGACAAAGGG - Intronic
1095991591 12:48038126-48038148 GAAAGTGAACCAATGACAGAGGG + Intergenic
1096536326 12:52277476-52277498 AAGGGTAGACCAAGGACAGAAGG - Intronic
1098796038 12:74889089-74889111 AAGGGTGAAACAAGGCGATATGG - Intergenic
1098858162 12:75677672-75677694 AATGGTTAATCAAGGACAGTGGG + Intergenic
1100604891 12:96143548-96143570 AAGGATGCACCAAGGACCGCAGG + Intergenic
1100785278 12:98071782-98071804 AAGGGGGTGCCATGGACAGATGG + Intergenic
1104705607 12:130944266-130944288 AGGAGAGAACAAAGGACAGATGG - Intergenic
1105512605 13:21062774-21062796 GAGGATGAACCAGGGACTGAAGG - Intergenic
1108700394 13:52938837-52938859 ATGGGGGAACCAAGGAGACAAGG - Intergenic
1109035142 13:57248814-57248836 AAGTGTAAACCAAGAAAAGAGGG - Intergenic
1109426490 13:62171103-62171125 AAGGATGAGACAAGAACAGATGG + Intergenic
1110534872 13:76639415-76639437 AAGGATAAAGCAAGGAAAGAAGG - Intergenic
1110908720 13:80926978-80927000 AAGGGAAAACAAAGAACAGAGGG - Intergenic
1111002800 13:82206454-82206476 AAGGGTGAGCCAAGCATGGAGGG - Intergenic
1111050417 13:82876567-82876589 ATGGGTTGACCAAAGACAGAGGG - Intergenic
1112942898 13:104888214-104888236 AAGGGAGAAAAAAGGAAAGAAGG - Intergenic
1113104752 13:106759963-106759985 ATGAGTGAACCCAGGTCAGATGG - Intergenic
1113293235 13:108928224-108928246 AAGTGTGTACCGACGACAGAGGG + Intronic
1113521325 13:110943525-110943547 AAGGGCAAACAAAGGACTGAGGG + Intergenic
1113826274 13:113256531-113256553 CAGGGTGAGCGAAGGACAGGTGG - Intronic
1117918293 14:60701637-60701659 AAGGGGGAAGGAAGGAAAGAAGG - Intergenic
1117918317 14:60701727-60701749 AAGAGTGAAGGAAGGAAAGAGGG - Intergenic
1120099778 14:80431500-80431522 AAGGGTGAACAAAGTAGACAGGG - Intergenic
1120506816 14:85362983-85363005 AAGGGAGCACAAAGGAAAGAGGG + Intergenic
1121734620 14:96209419-96209441 AAGGATGCACCCAGGAAAGAGGG + Intronic
1121899862 14:97684198-97684220 GAGGGTGAACTTTGGACAGAAGG - Intergenic
1124506267 15:30277240-30277262 AAAGGAGAACAAAGAACAGATGG + Intergenic
1124737289 15:32261396-32261418 AAAGGAGAACAAAGAACAGATGG - Intergenic
1127216481 15:56828504-56828526 AAGGGAGAACCAATGTGAGAGGG + Intronic
1127318226 15:57817479-57817501 AAGGGAGAAGCGAGGACACACGG - Intergenic
1127654728 15:61045503-61045525 AAGGCTGAGACAAGGACAGAAGG + Intronic
1129047187 15:72746123-72746145 AAGGATGAACAGAGCACAGAGGG + Intergenic
1129181802 15:73882413-73882435 AAGGGTGAACCAAGGACAGAGGG - Intronic
1130025699 15:80268776-80268798 AAGGGTGAGGCAAGGACAAGAGG + Intergenic
1131324366 15:91428276-91428298 AGGGGACAATCAAGGACAGAGGG - Intergenic
1131417329 15:92272042-92272064 AAGAGTTAAGGAAGGACAGAGGG + Intergenic
1131744352 15:95430045-95430067 AAGGAAGGACCAAGGAAAGAAGG - Intergenic
1134750692 16:16622694-16622716 AAGAGTGAACCAAAGGCAAAAGG - Intergenic
1134824151 16:17271023-17271045 AAGTCAGACCCAAGGACAGAGGG + Intronic
1134994763 16:18730896-18730918 AAGAGTGAACCAAAGGCAAAAGG + Intergenic
1138322185 16:56125117-56125139 AAGGGAGAAGGAAGGACAAAGGG - Intergenic
1139580179 16:67868457-67868479 GTGGGAGAACCAAGGCCAGAAGG - Intronic
1140588927 16:76327908-76327930 AGGGGTGAAACAATGACGGAAGG - Intronic
1140778617 16:78273759-78273781 AATGGAGAAGGAAGGACAGAAGG + Intronic
1140955180 16:79856855-79856877 TAGTGTGACCCATGGACAGAAGG - Intergenic
1141081804 16:81059642-81059664 GAGGGTGGAGGAAGGACAGAGGG + Intronic
1141475085 16:84267555-84267577 AAGGGTTAACCCTGGACAGCAGG - Intergenic
1141821521 16:86449489-86449511 CGGGGTGAAACAAGCACAGAGGG - Intergenic
1203143330 16_KI270728v1_random:1783485-1783507 TATGGTGAAACAAGGTCAGAGGG + Intergenic
1143099309 17:4496761-4496783 AAGGGGCCACCAAGGGCAGAGGG - Intergenic
1143301314 17:5912585-5912607 AAGGGTGCACAAGGCACAGAAGG + Intronic
1144799905 17:17919000-17919022 AAGGGAGAACCGGGGACAGCTGG - Intronic
1145726116 17:27126421-27126443 ATGGGTGAAGGAAGGAGAGAAGG + Intergenic
1147165447 17:38590866-38590888 TAGGGTGTAGGAAGGACAGAGGG - Intronic
1149092391 17:52799649-52799671 AATGGTAAACAAAGGACAGCAGG + Intergenic
1151228436 17:72664260-72664282 AAGGGTAAGCCATGGACTGAAGG + Intronic
1151548967 17:74810393-74810415 CAGGGGGAGCCAAGGACAAAGGG + Intronic
1151944257 17:77310938-77310960 ACGGTTCAACCTAGGACAGAAGG - Intronic
1152395723 17:80031633-80031655 AAGGGTGCACAAATGGCAGATGG - Intronic
1152401044 17:80066276-80066298 AAGGCTGGACCAAGGAATGAGGG + Intronic
1203166508 17_GL000205v2_random:101998-102020 CTGGGTGAACCAGGAACAGAAGG + Intergenic
1153455950 18:5282391-5282413 ACAGGTGAAAGAAGGACAGAAGG - Intergenic
1155705990 18:28813440-28813462 GAGGGTGATCCAATGGCAGAAGG + Intergenic
1155722740 18:29038845-29038867 AAGTGTGAAGATAGGACAGAAGG + Intergenic
1155966897 18:32044686-32044708 AAAGGTAATCCAAGGACAGCTGG - Intronic
1156030866 18:32710764-32710786 AAGGGTGAGAAATGGACAGATGG + Intronic
1156352352 18:36311977-36311999 AAGGGTGGAAGAAGGACAGCTGG - Intronic
1157472419 18:47999951-47999973 AGGGAGGAACCAAGGAAAGAAGG - Intergenic
1161904037 19:7141875-7141897 AAGGTTGCACCATGGACAGGTGG - Intronic
1163383591 19:16985475-16985497 AAGGGTGGATGAAGGGCAGACGG + Intronic
1163404457 19:17113566-17113588 CAGGGTGGTGCAAGGACAGAAGG + Intronic
1163779934 19:19240735-19240757 AAGGGTAAACTGAGGCCAGATGG - Intronic
1164024244 19:21336104-21336126 AAGGGAGAACAAAGGAAAGGAGG + Intergenic
1164550939 19:29212146-29212168 AACGGGGATCTAAGGACAGAGGG + Intronic
1164853071 19:31500639-31500661 GAGGGAGGACCAAGGACAGGAGG + Intergenic
1165121912 19:33565352-33565374 AAGGGGGCCCCAAGGGCAGATGG - Intergenic
1166320045 19:42012011-42012033 AAAGGGGAACAAAGAACAGATGG + Intronic
1166426704 19:42685397-42685419 AAGAGTGACCCAAGGAAAGTGGG + Intronic
1166852949 19:45769049-45769071 AAGGGAGAATCACAGACAGACGG - Exonic
924964212 2:60249-60271 GAGGCTGACCCCAGGACAGAGGG + Intergenic
925621433 2:5797301-5797323 ATGGTTAAACCAAGGACACAAGG - Intergenic
927374294 2:22395559-22395581 CAGGGTGAACAAAAGATAGAAGG + Intergenic
929435336 2:41924441-41924463 GAGGGGTAACCCAGGACAGAAGG + Intergenic
930818060 2:55619273-55619295 AAGGGTGAGGCTTGGACAGAAGG - Intergenic
931445742 2:62325750-62325772 AAGGGAGAACAAAGGAAAGGAGG + Intergenic
935535080 2:104284465-104284487 AATGGTGACCCAAAGAGAGACGG - Intergenic
936272809 2:111063892-111063914 AAGAATGAAGCAAGGAAAGAAGG + Intronic
937275855 2:120683698-120683720 AAGCTGGAAGCAAGGACAGATGG - Intergenic
937346315 2:121127998-121128020 ATGGGCGCACCCAGGACAGAAGG - Intergenic
938641300 2:133283324-133283346 GGGGGTGAACAAAGGACAAAAGG - Intronic
938940527 2:136165572-136165594 AAGGATGAAAGAAGGAAAGAAGG - Intergenic
939017510 2:136919758-136919780 AAGGGTGAGCCAGGTGCAGAGGG + Intronic
940113801 2:150185033-150185055 ATGGGTGCTCCAGGGACAGACGG - Intergenic
940274911 2:151929151-151929173 CAGGGGGAAGCAAGGAGAGATGG + Intronic
940693539 2:156950387-156950409 AACGGTGAACTAAGTCCAGATGG + Intergenic
940892309 2:159046973-159046995 AAGGATGAACCAGGAACATAAGG - Intronic
942070478 2:172311539-172311561 AACGGTCCACCATGGACAGAGGG + Intergenic
942462734 2:176179527-176179549 CAGACTGAACCAAGGACAGCAGG - Intergenic
943452040 2:188055246-188055268 AAAGGGGACCCAAGGACACATGG + Intergenic
943760814 2:191606725-191606747 AAGGATGAAGGAAGGAAAGAAGG - Intergenic
945029536 2:205650551-205650573 AAGAGTGAAGCAAGGACGGAAGG - Intergenic
946895051 2:224315309-224315331 AAAAGTGAACAAAGAACAGATGG - Intergenic
947281591 2:228461100-228461122 AAGGGAGAGCCAAGGCAAGATGG - Intergenic
1170756589 20:19211737-19211759 AAGTGTGAGCCCAAGACAGAGGG + Intergenic
1172225569 20:33303046-33303068 CAGGGTGAACAAAGGGCGGAGGG - Exonic
1173435444 20:43028313-43028335 AAGGGCAAAGCAAGGACAAAAGG - Intronic
1173586824 20:44188641-44188663 AAGAGAGAACTAAGCACAGAAGG + Intergenic
1173603074 20:44309950-44309972 GAAGGTGGACCAAGGACAGAAGG + Intronic
1174544907 20:51318039-51318061 AAGGGAGAAAGAAAGACAGAGGG - Intergenic
1175997635 20:62818601-62818623 AAGGGGGAACTCAGAACAGAGGG + Intronic
1176335028 21:5588547-5588569 CTGGGTGAACCATGAACAGAAGG - Intergenic
1176392729 21:6232401-6232423 CTGGGTGAACCATGAACAGAAGG + Intergenic
1176405247 21:6357098-6357120 CTGGGTGAACCAGGAACAGAAGG - Intergenic
1176431910 21:6632005-6632027 CTGGGTGAACCAGGAACAGAAGG + Intergenic
1176468690 21:7083773-7083795 CTGGGTGAACCATGAACAGAAGG - Intronic
1176492251 21:7465551-7465573 CTGGGTGAACCATGAACAGAAGG - Intergenic
1176508391 21:7672832-7672854 CTGGGTGAACCATGAACAGAAGG + Intergenic
1177286972 21:19064375-19064397 GAGGGTGAACTCAGGTCAGATGG + Intergenic
1178228909 21:30757868-30757890 ACGGAAGAACCAAGGAGAGAGGG - Intergenic
1179446427 21:41434503-41434525 AAGGGGGAACGAAGAACAGACGG - Intronic
1179619721 21:42605479-42605501 AAGGGAGAACAAAGGAAAGGAGG + Intergenic
1181518401 22:23431451-23431473 AAGGCTGAACCAAGCACATCGGG - Intergenic
1181592106 22:23891860-23891882 AAGGCTGAGCCAAGAACTGAAGG + Intronic
1181981272 22:26768538-26768560 AAGGTTGACCCAAGGCCAGTCGG - Intergenic
1183231428 22:36584550-36584572 AAGAGTGAACCAAATAAAGAGGG - Intronic
1185289920 22:50018070-50018092 AAGGGTGAATCAAAAACAGCAGG + Intronic
950563575 3:13750286-13750308 AAAGGTGAAGCAAGGAGTGAGGG + Intergenic
951349543 3:21589205-21589227 AAGGCTGAAGGAAGTACAGAAGG + Intronic
953438220 3:42896695-42896717 AAGAGAGAACAAAGGAGAGAAGG - Intronic
953771027 3:45778852-45778874 TAGGTTGAACCAGGGAAAGAAGG + Intronic
954522311 3:51239658-51239680 AAGAGTGAACCAAGAAGAAATGG - Intronic
955123750 3:56088465-56088487 AAGGGGGAAAAAATGACAGAGGG + Intronic
955143256 3:56290762-56290784 CAGGTTGAACCCAGGACAGTGGG - Intronic
956857988 3:73294624-73294646 TAGGGTGCACCGAGGAAAGAAGG - Intergenic
958692414 3:97484755-97484777 AAGGAAGAGCCAAGAACAGAAGG - Intronic
958744869 3:98120504-98120526 AAAAGTGAACAAAAGACAGATGG + Intergenic
962463371 3:135635161-135635183 AAGGGTACATGAAGGACAGATGG + Intergenic
963612592 3:147490297-147490319 AAGGGTAAACTAAGGAGAAAAGG + Intronic
966961155 3:184940544-184940566 AAGAGTGAAACAAGGGCAGGAGG - Intronic
969571753 4:8012901-8012923 AAGGGTGAACAGAGGGTAGATGG - Intronic
970369620 4:15393961-15393983 AAGGGGGAAGTAAGGGCAGAGGG + Intronic
970434282 4:16018391-16018413 ATGGATGCACCAAGCACAGAGGG + Exonic
972441329 4:39096004-39096026 AATGGAGAACCAAGCACAAAAGG + Intronic
974386693 4:61209607-61209629 AAAGGTTAAAAAAGGACAGAGGG - Intronic
974801927 4:66828779-66828801 AAGGGTGAAACTAAGAAAGAGGG - Intergenic
978592883 4:110345199-110345221 AAGGGGGAAGAAAGGAAAGAAGG - Intergenic
980745122 4:137002136-137002158 ATGGGTGAGCCAGGCACAGAGGG - Intergenic
982178379 4:152727902-152727924 AAGGAGGAACCAAGGGCAGCTGG + Intronic
984250595 4:177329186-177329208 AAAGATGAACAAAGAACAGATGG + Intronic
985358886 4:189151141-189151163 AAGGGGGAACAAAGGAAAGAAGG - Intergenic
986006417 5:3672478-3672500 GTGGGTGAAGCAGGGACAGAAGG - Intergenic
986251232 5:6060279-6060301 AAGGGAGAAACAAGGAAAGTGGG + Intergenic
986789687 5:11147618-11147640 AAGAGTGATACAAAGACAGATGG + Intronic
986943214 5:12982264-12982286 AAGGATCAGCAAAGGACAGATGG + Intergenic
989219597 5:38942102-38942124 AAGGCTCAACAAAGGAGAGAAGG + Exonic
989224951 5:39016161-39016183 AAGCTTGCACCAAGGCCAGAGGG + Intronic
990174746 5:53094971-53094993 AAGTGTGGCCCAGGGACAGATGG + Intergenic
990316359 5:54586517-54586539 AAGGGTCACCCCATGACAGAGGG + Intergenic
994891440 5:105640553-105640575 AAGGGTGAGCCACGTACGGAGGG - Intergenic
995670084 5:114593334-114593356 TAGGGTGGTCCAAGGAGAGAGGG + Intergenic
996182005 5:120431032-120431054 AAGACTGAACCTACGACAGATGG - Intergenic
998037048 5:138926253-138926275 AGGACTGAACCAAGGACACAAGG - Intronic
998238324 5:140419901-140419923 GAGGGGGAAGGAAGGACAGACGG - Intronic
998559062 5:143154279-143154301 AATGGAGAACCAAGGAGATAGGG + Intronic
998761537 5:145437720-145437742 AGGAATGAACCAAGGAGAGAAGG - Intergenic
1000129034 5:158276943-158276965 CAGTGTGAACCAAGGCCTGAAGG + Intergenic
1001090186 5:168734319-168734341 AAAGATGAACCAAAGACAGGAGG - Intronic
1002018055 5:176341552-176341574 AAGGGTGTGGCAAGGACAGAAGG + Intronic
1002561235 5:180083703-180083725 AAGGTTGAGACAGGGACAGAGGG - Intergenic
1002681951 5:180972162-180972184 AAGGCTGAACCAAGAATAAATGG + Intergenic
1004399424 6:15274734-15274756 CAGGCTGAACCAAAGACTGAAGG - Intronic
1005203186 6:23370288-23370310 TAGTGGGAATCAAGGACAGAAGG - Intergenic
1006521194 6:34572192-34572214 AAGGCTGACCCAGGGAAAGACGG - Intergenic
1006591132 6:35158585-35158607 AAGGGGGAAGGAAGGAAAGAAGG - Intergenic
1006977659 6:38118501-38118523 AAGGAAGAAACAAGAACAGAAGG - Intronic
1008071232 6:47100944-47100966 AAATGTGAACCAAGAACAAAAGG - Intergenic
1009835014 6:68988930-68988952 TAGTCTGAACCAAGAACAGATGG + Intronic
1009871384 6:69456371-69456393 AAGGGTGAAAAAAGCTCAGAGGG + Intergenic
1010504972 6:76645845-76645867 AAGGGTTGACCAAGGCCACAGGG - Intergenic
1010808356 6:80266040-80266062 AAGGGTCTTCTAAGGACAGAAGG + Intronic
1010967550 6:82229169-82229191 GAGGGTGAAGCAAGCACAGTGGG - Intronic
1013094254 6:106929948-106929970 AAGGATGAAGAAAGGACATATGG - Intergenic
1015121100 6:129702501-129702523 AAGGGTGGGCACAGGACAGAGGG + Intronic
1015914858 6:138205454-138205476 AAGTAGGAACCAAGGGCAGATGG - Intronic
1016324037 6:142879580-142879602 AAGTGAAAACCAAGGAGAGAAGG - Intronic
1016616400 6:146053570-146053592 AAGGATGAATAAAGGACTGATGG + Intronic
1017613911 6:156223489-156223511 AATGGTGAACCAATGAAAAATGG + Intergenic
1017699518 6:157054842-157054864 AGCGGTGAACCATGGACAGGAGG - Intronic
1020839647 7:13199571-13199593 AAGCTAGAACCAAGGAGAGAGGG + Intergenic
1022284985 7:28948461-28948483 AAGGGTGAGCCCGGGCCAGATGG + Intergenic
1022609269 7:31852911-31852933 TAGAGGGAACCAGGGACAGATGG - Intronic
1023089183 7:36601800-36601822 AAGAGAGAACCAAGCACAGAGGG + Intronic
1023288755 7:38646900-38646922 AGGGATGAATCAAGGACACAGGG + Intergenic
1023974416 7:45017287-45017309 AAAGGTGAAGCAAGGAGACAGGG + Intronic
1024475556 7:49804775-49804797 AGGAGAGAACCAAAGACAGAGGG - Intronic
1032419516 7:131766498-131766520 CAGCGTGAACCCAGGACAGAGGG + Intergenic
1032866921 7:135935166-135935188 AATGGAGAACCAAGGACAGATGG - Intronic
1034980695 7:155474218-155474240 AAGGGTGAAGCAAACACCGATGG + Intronic
1035303377 7:157913370-157913392 AAGGGTGCACTTAGGAGAGAAGG - Intronic
1036758127 8:11485062-11485084 AAGGGAGAAAGAAAGACAGAGGG + Intergenic
1038142750 8:24864355-24864377 ATGGGGGAACCAAGCAAAGATGG - Intergenic
1038455825 8:27671274-27671296 AAGGGTGAACCAGGGATCCAGGG + Exonic
1039793774 8:40895647-40895669 AAGGGTGAGTCATGCACAGAGGG - Intronic
1040549687 8:48428545-48428567 GAGGGTGAACCAAGGAAGGAGGG + Intergenic
1040913703 8:52546610-52546632 AAGGGAGAACCAAGAAGAAAAGG - Intronic
1041529917 8:58853846-58853868 AAAGTTGTGCCAAGGACAGAGGG + Intronic
1043132516 8:76479354-76479376 GATGGTGAACCATGGACAGAAGG - Intergenic
1044390023 8:91639122-91639144 AAGGAAGAACCAAGGAAAAAAGG - Intergenic
1048064720 8:130956209-130956231 AAGGGTTAACCAAGGAGAGCTGG - Intronic
1048520263 8:135147366-135147388 ATGGCTGAGCCCAGGACAGATGG + Intergenic
1049627548 8:143632543-143632565 AAAGGTGAAAGAAGAACAGAAGG - Intergenic
1051470991 9:17441867-17441889 AAGGGTAAGCAAAGGAGAGAAGG + Intronic
1052047778 9:23814392-23814414 AAGGATAAACAAGGGACAGAGGG + Intronic
1052856263 9:33408393-33408415 AAGGCTGGAGCATGGACAGAGGG + Intergenic
1054393424 9:64633729-64633751 ATGGGTGAGCCATGAACAGAGGG + Intergenic
1054428074 9:65138943-65138965 ATGGGTGAGCCATGAACAGAGGG + Intergenic
1054502305 9:65882601-65882623 ATGGGTGAGCCATGAACAGAGGG - Intronic
1056982745 9:91331231-91331253 AAAGGTGAAGAAAGTACAGACGG + Intronic
1058189830 9:101899807-101899829 AAGGGTGATAGAAGGACATAGGG - Intergenic
1058910472 9:109516107-109516129 AAGAGTGGACCTAGGACAGATGG - Intergenic
1060247583 9:121959211-121959233 TGGGGTGAACCCAGGACAGGAGG - Intronic
1062167530 9:135115388-135115410 ATGGGTGACGCAGGGACAGAGGG + Intronic
1203426612 Un_GL000195v1:46369-46391 CTGGGTGAACCATGAACAGAAGG + Intergenic
1203439629 Un_GL000195v1:176703-176725 CTGGGTGAACCAGGAACAGAAGG - Intergenic
1188523443 X:31063209-31063231 AAGTGAGAAACAAGGAAAGAGGG - Intergenic
1190411165 X:50138649-50138671 AAGGCTGAAGCTAGGATAGATGG + Intergenic
1190529438 X:51360609-51360631 ATGGGAGAAACAAGGACAAAAGG + Intergenic
1191176897 X:57513666-57513688 AAGACTGAACCAAGAACACAGGG - Intergenic
1192763994 X:74124323-74124345 AATGGTGAACCCAATACAGAGGG + Intergenic
1193226644 X:78991553-78991575 AAGGATGAACCCAGCAGAGAAGG - Intergenic
1193901892 X:87189755-87189777 CAGGGTGAAACAAGGAAAGTTGG + Intergenic
1195613170 X:106892061-106892083 AAGGCTGAAGCACGGAGAGAGGG + Intronic
1196558337 X:117117951-117117973 AAGTGTGATCCATGGACAAAAGG - Intergenic
1197174693 X:123473134-123473156 CAGGCTGATCCAAGGATAGAAGG + Intronic
1198517240 X:137421811-137421833 GAGGAAGAACCAAGGACTGAGGG + Intergenic
1198682098 X:139194091-139194113 TAGGGGTAACCAAGGAGAGATGG - Intronic
1199520052 X:148725149-148725171 AAGGGTTCTCCAAGGACTGATGG - Intronic
1199740440 X:150730747-150730769 AAGAGAGAATCAAGGAAAGATGG - Intronic
1201064879 Y:10088409-10088431 GAAGGTGAACAAGGGACAGAGGG + Intergenic
1201490424 Y:14535478-14535500 AAGGGTGACCCAGGGAGAAAGGG + Intronic
1202196291 Y:22301130-22301152 AAGGCTGAAGGAAGGAAAGAAGG + Intergenic