ID: 1129184746

View in Genome Browser
Species Human (GRCh38)
Location 15:73899268-73899290
Sequence GGTGCATCCAGCTGTGAGCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1129184746_1129184756 25 Left 1129184746 15:73899268-73899290 CCTGGCTCACAGCTGGATGCACC No data
Right 1129184756 15:73899316-73899338 GCTCACAGGAAGCTGCCATCTGG No data
1129184746_1129184752 11 Left 1129184746 15:73899268-73899290 CCTGGCTCACAGCTGGATGCACC No data
Right 1129184752 15:73899302-73899324 ACCTGAGGGCTCCCGCTCACAGG No data
1129184746_1129184748 -3 Left 1129184746 15:73899268-73899290 CCTGGCTCACAGCTGGATGCACC No data
Right 1129184748 15:73899288-73899310 ACCCTCAATTCCTGACCTGAGGG No data
1129184746_1129184747 -4 Left 1129184746 15:73899268-73899290 CCTGGCTCACAGCTGGATGCACC No data
Right 1129184747 15:73899287-73899309 CACCCTCAATTCCTGACCTGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1129184746 Original CRISPR GGTGCATCCAGCTGTGAGCC AGG (reversed) Intergenic
No off target data available for this crispr