ID: 1129184794

View in Genome Browser
Species Human (GRCh38)
Location 15:73899485-73899507
Sequence CTGTGTGAGGGGAACCTGAA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1129184781_1129184794 26 Left 1129184781 15:73899436-73899458 CCTTGCCCTGGGCCATGCTCCCA No data
Right 1129184794 15:73899485-73899507 CTGTGTGAGGGGAACCTGAAAGG No data
1129184787_1129184794 7 Left 1129184787 15:73899455-73899477 CCCACTTGATGCCAGGGCTGTGC No data
Right 1129184794 15:73899485-73899507 CTGTGTGAGGGGAACCTGAAAGG No data
1129184788_1129184794 6 Left 1129184788 15:73899456-73899478 CCACTTGATGCCAGGGCTGTGCT No data
Right 1129184794 15:73899485-73899507 CTGTGTGAGGGGAACCTGAAAGG No data
1129184789_1129184794 -4 Left 1129184789 15:73899466-73899488 CCAGGGCTGTGCTTCCGCTCTGT No data
Right 1129184794 15:73899485-73899507 CTGTGTGAGGGGAACCTGAAAGG No data
1129184784_1129184794 14 Left 1129184784 15:73899448-73899470 CCATGCTCCCACTTGATGCCAGG No data
Right 1129184794 15:73899485-73899507 CTGTGTGAGGGGAACCTGAAAGG No data
1129184782_1129184794 21 Left 1129184782 15:73899441-73899463 CCCTGGGCCATGCTCCCACTTGA No data
Right 1129184794 15:73899485-73899507 CTGTGTGAGGGGAACCTGAAAGG No data
1129184783_1129184794 20 Left 1129184783 15:73899442-73899464 CCTGGGCCATGCTCCCACTTGAT No data
Right 1129184794 15:73899485-73899507 CTGTGTGAGGGGAACCTGAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1129184794 Original CRISPR CTGTGTGAGGGGAACCTGAA AGG Intergenic
No off target data available for this crispr