ID: 1129186747

View in Genome Browser
Species Human (GRCh38)
Location 15:73911898-73911920
Sequence ACTCCAGGTAGAGCGTCCAA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1129186747_1129186752 -10 Left 1129186747 15:73911898-73911920 CCCTTGGACGCTCTACCTGGAGT No data
Right 1129186752 15:73911911-73911933 TACCTGGAGTGGGGAAAGAACGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1129186747 Original CRISPR ACTCCAGGTAGAGCGTCCAA GGG (reversed) Intergenic
No off target data available for this crispr