ID: 1129188931

View in Genome Browser
Species Human (GRCh38)
Location 15:73926632-73926654
Sequence TGGCCTTGTCCCGAGCGGGA CGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 89
Summary {0: 1, 1: 0, 2: 0, 3: 4, 4: 84}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1129188931_1129188938 1 Left 1129188931 15:73926632-73926654 CCGTCCCGCTCGGGACAAGGCCA 0: 1
1: 0
2: 0
3: 4
4: 84
Right 1129188938 15:73926656-73926678 CATGGACAAAGCTAGAGCTGGGG 0: 1
1: 0
2: 2
3: 23
4: 236
1129188931_1129188937 0 Left 1129188931 15:73926632-73926654 CCGTCCCGCTCGGGACAAGGCCA 0: 1
1: 0
2: 0
3: 4
4: 84
Right 1129188937 15:73926655-73926677 GCATGGACAAAGCTAGAGCTGGG 0: 1
1: 0
2: 0
3: 7
4: 158
1129188931_1129188936 -1 Left 1129188931 15:73926632-73926654 CCGTCCCGCTCGGGACAAGGCCA 0: 1
1: 0
2: 0
3: 4
4: 84
Right 1129188936 15:73926654-73926676 AGCATGGACAAAGCTAGAGCTGG 0: 1
1: 0
2: 0
3: 9
4: 172
1129188931_1129188939 10 Left 1129188931 15:73926632-73926654 CCGTCCCGCTCGGGACAAGGCCA 0: 1
1: 0
2: 0
3: 4
4: 84
Right 1129188939 15:73926665-73926687 AGCTAGAGCTGGGGCAAGCAAGG 0: 1
1: 0
2: 1
3: 22
4: 295
1129188931_1129188940 29 Left 1129188931 15:73926632-73926654 CCGTCCCGCTCGGGACAAGGCCA 0: 1
1: 0
2: 0
3: 4
4: 84
Right 1129188940 15:73926684-73926706 AAGGAGCCTTCCTGTCCTCGAGG 0: 1
1: 0
2: 0
3: 10
4: 137

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1129188931 Original CRISPR TGGCCTTGTCCCGAGCGGGA CGG (reversed) Exonic
900298720 1:1965860-1965882 TGGCCCTGTCCCACGTGGGAGGG - Intronic
900606711 1:3526889-3526911 TGACCTTGCCTCGAGAGGGAAGG + Intronic
901019597 1:6249156-6249178 TGGCCTTGTCCCAGGGGCGACGG - Exonic
907237432 1:53062021-53062043 CGGCCAAGTCCCGAGCGGGGAGG + Intergenic
914704094 1:150157414-150157436 TTGCCCTGTCTCGAGTGGGATGG - Exonic
915108215 1:153547250-153547272 TGGCCTTTTCCACTGCGGGAAGG - Intronic
919486273 1:198151514-198151536 TGGCCTTCTCCAGAGCTTGAAGG + Intergenic
919757371 1:201074431-201074453 AGGCCCTGTCCAGAGCTGGAAGG + Intronic
922895018 1:229093192-229093214 TGGCCTTGTCCCTGGCTGGGTGG + Intergenic
1068660014 10:59614083-59614105 TGGCCATGTCCCTAGCATGAGGG - Intergenic
1073293023 10:102422668-102422690 TGCCCCTGCCCCGAGCTGGAGGG + Intronic
1076110600 10:127856385-127856407 GGGGCTTGGCCCGAGGGGGAAGG - Intergenic
1076244027 10:128932355-128932377 CGGCCTTGTCGTGAGCGGGTGGG - Intergenic
1077365130 11:2158528-2158550 TGGCCAGGTCCCCAGCTGGAGGG + Intronic
1081536894 11:44002887-44002909 TGGCCTTGTCCAGGGCTGGAGGG + Intergenic
1083990150 11:66241800-66241822 TGGCCTTGTCCCTCGAGGGGAGG - Intronic
1084810225 11:71607511-71607533 AGGCCTGGTCCCGAGCAGGCTGG + Intergenic
1090662282 11:128890879-128890901 TCGCCGTTTCCCGAGAGGGATGG - Intergenic
1101371872 12:104137990-104138012 CGGCCTCGGCCCGCGCGGGAGGG + Intronic
1101726987 12:107395950-107395972 TGGCCTTGTCCACAGCAGGGAGG + Intronic
1104537773 12:129634094-129634116 TGGCGTTGTCACGTGTGGGAAGG + Intronic
1112153621 13:96792950-96792972 TGGCGTGGTGCCGAGAGGGAAGG - Intronic
1116577099 14:46588311-46588333 TTGCCCTGCCCAGAGCGGGAAGG - Intergenic
1119742641 14:77024364-77024386 TAGCCTGGTACCGAGGGGGAGGG + Intergenic
1119802371 14:77457510-77457532 TGGCGCTGTCCTGAGAGGGAGGG - Exonic
1121509181 14:94499792-94499814 TGGCCTGGTCCACAGTGGGAGGG + Intronic
1128453466 15:67820492-67820514 AGGCCCTGTCCAGAGCGGGCAGG - Intronic
1128815046 15:70602212-70602234 TGGCCCTGTCCAGAGGGGCAGGG - Intergenic
1128980744 15:72184034-72184056 TGGTCTTTTCCCGCGAGGGAGGG - Intronic
1129188931 15:73926632-73926654 TGGCCTTGTCCCGAGCGGGACGG - Exonic
1129382149 15:75174640-75174662 TGTGCGTGTCCCGAGCTGGAGGG + Intergenic
1136076353 16:27819993-27820015 TGGGCTTGTGGTGAGCGGGAGGG + Intronic
1136690463 16:32024890-32024912 TGGGCTTCCCCCGAGCGGGTGGG + Intergenic
1137718136 16:50611413-50611435 GGGCCTGGTCCCGAGGAGGAGGG - Intronic
1139664578 16:68447349-68447371 TGGGCATGTACAGAGCGGGACGG - Intronic
1140455885 16:75105315-75105337 TGGCCTTCTCCCTAGAGGGCCGG + Intronic
1147153322 17:38531025-38531047 TGGGCTTCACCCGAGCGGGTGGG + Exonic
1149040901 17:52187032-52187054 TGGTCTTGTCCCCAGAAGGAGGG + Intergenic
1151763310 17:76119669-76119691 TGGCCTTGGCCCGACCCAGAGGG + Intronic
1158848693 18:61472112-61472134 TGCCCTTGTCTGGAGGGGGAAGG - Intronic
1160738689 19:676276-676298 AGGCCGTGTCCCGCGCGGGGTGG - Intergenic
1161376389 19:3941198-3941220 AGGCCTTGCCCCGGGCGGGCGGG + Intronic
1164193800 19:22935610-22935632 TGGGCTTTTCCCCAGCAGGAGGG - Intergenic
1166343371 19:42151344-42151366 TAGCCTTGACCCGAGGGGGAGGG - Intronic
1166722120 19:45002636-45002658 AGCCCTTGTGCCCAGCGGGATGG + Intronic
931228407 2:60353223-60353245 TGGCCTTTCCCAGAGCTGGAGGG - Intergenic
935267659 2:101408616-101408638 TGACCATGTCCAGAGCTGGATGG - Intronic
937040083 2:118814271-118814293 TGGTCTTGTCCCAAGCAGCAAGG - Intergenic
938251159 2:129816880-129816902 TGGCCTTGTGCCCAGTGGAAAGG + Intergenic
946366638 2:219253038-219253060 CCGCCTTGTCCCGGGCAGGATGG + Intronic
947669529 2:231927426-231927448 TGGCCATGTCCCGAGAGCCACGG - Intergenic
1169057406 20:2634972-2634994 TGGCCTAGCCCTGAGGGGGAAGG + Intronic
1169269433 20:4187825-4187847 TGGCTGTGTCCCCAGAGGGAAGG + Intergenic
1171144415 20:22769039-22769061 GGGCTCTGTCCCGAGCTGGATGG - Intergenic
1172641940 20:36445745-36445767 TGGCCTGGGCCACAGCGGGAGGG - Intronic
1174758145 20:53180333-53180355 TGGCATTTTCCCTAGAGGGATGG + Intronic
1175972858 20:62695684-62695706 AAGGCTTGTCCAGAGCGGGAGGG + Intergenic
1178925706 21:36773326-36773348 TGGCCTTGGCCTGTGCGGCAGGG - Intronic
1181024558 22:20120636-20120658 TGCCCTGGTCCCCAGCGGGAGGG + Intronic
1184119607 22:42441310-42441332 TGGCCCTGACCCCAGCTGGAAGG - Intergenic
1184163435 22:42713231-42713253 TGGCCTTGACCCAAGGGGGCGGG - Intronic
954332963 3:49900652-49900674 TTGGCTTGGCCCGAGCCGGAAGG + Intronic
954916210 3:54150428-54150450 TGCCCTTCTCCAGAGAGGGAAGG - Intronic
963009599 3:140756646-140756668 TTGCCTTGTCCTGAGAGAGAAGG - Intergenic
963839509 3:150091194-150091216 TGACCTGGTCCCAAGGGGGAAGG + Intergenic
968051872 3:195660081-195660103 TGTCCTTTTCCCCAGGGGGATGG + Intergenic
968103943 3:195988254-195988276 TGTCCTTTTCCCCAGGGGGATGG - Intergenic
968302245 3:197625844-197625866 TGTCCTTTTCCCCAGGGGGATGG - Intergenic
969689709 4:8697809-8697831 TGGCCTTGTACACAGCGGGTAGG + Intergenic
984241879 4:177227944-177227966 TGGCCTTGGCCCGCCCAGGAAGG + Intergenic
984871123 4:184325975-184325997 TGACCTTCTCCCGAGCAAGAGGG + Intergenic
991957305 5:72007997-72008019 TGTCCTTGTCCTGGGAGGGAAGG + Intergenic
995532263 5:113103314-113103336 TGGCTTTGTCCCTAGCTGGTTGG + Intronic
999833196 5:155340556-155340578 TGGCCTATTCCTGAGTGGGAAGG - Intergenic
1002890076 6:1324617-1324639 TGGCTTTGCCCAGAGTGGGAAGG - Intergenic
1006108174 6:31729044-31729066 TGGCCAGATCCAGAGCGGGAAGG + Exonic
1014624843 6:123712846-123712868 GGTCCTTGTCCCGAGGGGTATGG + Intergenic
1024563103 7:50660833-50660855 GGGCCTTGGCCCTGGCGGGATGG - Intronic
1032401397 7:131626771-131626793 TGGCCTTGTGACGAGAGTGAAGG + Intergenic
1035728180 8:1837652-1837674 TGGCCTTGTCTAGGGCGGGAAGG + Intronic
1035936251 8:3844060-3844082 TGGCCTTGTTGAGAGTGGGATGG - Intronic
1056718774 9:89055680-89055702 TGGGCTTCTCCCAAGCAGGAGGG + Intronic
1057391188 9:94642706-94642728 TGGCCTAGTCCCAAGGGGAATGG - Intergenic
1061893694 9:133636014-133636036 TGGCCCAGTCCCCAGTGGGATGG - Intergenic
1062211518 9:135366806-135366828 AGGCCTTGGCCTGAGCGAGATGG - Intergenic
1062218036 9:135399689-135399711 TGTCCTTGTCCCCAGCAGCATGG + Intergenic
1196232449 X:113239931-113239953 TGGACCTGTCCTGAGCTGGAGGG - Intergenic
1199744957 X:150766673-150766695 TGGGCCTGTCCCAAGCGAGAGGG - Exonic
1200114835 X:153765458-153765480 GGGCATTGTCCTGAGTGGGAGGG - Exonic