ID: 1129188937

View in Genome Browser
Species Human (GRCh38)
Location 15:73926655-73926677
Sequence GCATGGACAAAGCTAGAGCT GGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 166
Summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 158}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1129188933_1129188937 -5 Left 1129188933 15:73926637-73926659 CCGCTCGGGACAAGGCCAGCATG 0: 1
1: 0
2: 0
3: 8
4: 88
Right 1129188937 15:73926655-73926677 GCATGGACAAAGCTAGAGCTGGG 0: 1
1: 0
2: 0
3: 7
4: 158
1129188926_1129188937 25 Left 1129188926 15:73926607-73926629 CCTTGAAATGCTGTCATCGGAGG 0: 1
1: 0
2: 0
3: 13
4: 96
Right 1129188937 15:73926655-73926677 GCATGGACAAAGCTAGAGCTGGG 0: 1
1: 0
2: 0
3: 7
4: 158
1129188932_1129188937 -4 Left 1129188932 15:73926636-73926658 CCCGCTCGGGACAAGGCCAGCAT 0: 1
1: 0
2: 1
3: 11
4: 79
Right 1129188937 15:73926655-73926677 GCATGGACAAAGCTAGAGCTGGG 0: 1
1: 0
2: 0
3: 7
4: 158
1129188931_1129188937 0 Left 1129188931 15:73926632-73926654 CCGTCCCGCTCGGGACAAGGCCA 0: 1
1: 0
2: 0
3: 4
4: 84
Right 1129188937 15:73926655-73926677 GCATGGACAAAGCTAGAGCTGGG 0: 1
1: 0
2: 0
3: 7
4: 158

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1129188937 Original CRISPR GCATGGACAAAGCTAGAGCT GGG Exonic
902148055 1:14420350-14420372 GCATTTACAAACCTTGAGCTAGG + Intergenic
903065225 1:20695942-20695964 TCATGTACCAAGCAAGAGCTGGG - Intronic
904655136 1:32039892-32039914 GCAGGGAAATAGCTAGACCTGGG + Intronic
908124190 1:61013837-61013859 TCATGGAGAGAGCTAGAGCAGGG + Intronic
909744968 1:79083545-79083567 GCAGGGACAAAGGTAGAGAGAGG - Intergenic
909919839 1:81367514-81367536 GCAGGGACATAGATGGAGCTGGG - Intronic
915269646 1:154744647-154744669 ACCTGGACAAAGGCAGAGCTGGG - Intronic
917245543 1:172996852-172996874 AAATGGACAAAGGTACAGCTTGG + Intergenic
920952016 1:210581361-210581383 CCAAGGCCAAAGCTAGAGCCAGG + Intronic
921988541 1:221338988-221339010 GCATGGCAAAAGGTAGAGGTGGG - Intergenic
922546902 1:226464539-226464561 GCATTTACAAACCTTGAGCTAGG - Intergenic
924195575 1:241603732-241603754 CCATGGCCAAAGCTAGAGACTGG + Intronic
1063885410 10:10572651-10572673 GCAGGGACACAGTTGGAGCTGGG - Intergenic
1064218521 10:13420017-13420039 ACATGGAAAAAGCTGGAGCCCGG - Intergenic
1069345610 10:67466348-67466370 GCATGTAGAAAGCTATTGCTGGG - Intronic
1070646576 10:78205987-78206009 CCATGGGCCAAGCTAGAGCTGGG - Intergenic
1077992535 11:7424785-7424807 GTATGCACAAAGGTTGAGCTTGG - Intronic
1079391927 11:20029332-20029354 ACATGGACACAGCAAGAGCCAGG - Intronic
1079645021 11:22852273-22852295 GCATGGACAAAGCTAACTATAGG + Intronic
1080721388 11:34852613-34852635 GCAGGGACATAGATGGAGCTGGG + Intergenic
1084793015 11:71486703-71486725 GGATGGACAAAGGGAGAGATGGG - Intronic
1088057325 11:105600925-105600947 GCATAGAGTAAGCTAGAACTGGG - Intergenic
1088502435 11:110496104-110496126 ACATTTACAAAGATAGAGCTGGG + Intergenic
1088517458 11:110653912-110653934 GCATGGACATGGATGGAGCTGGG + Intronic
1090088407 11:123671915-123671937 GCAGGTACAAACCCAGAGCTGGG - Intergenic
1091777938 12:3196905-3196927 GCCTGGACAAAGTGTGAGCTGGG + Intronic
1093495139 12:19748004-19748026 GCAGGGACAAGGATGGAGCTGGG - Intergenic
1093741282 12:22692903-22692925 GCATTTACAAACCTTGAGCTAGG + Intergenic
1094337416 12:29375761-29375783 GGATGGAGGAAGCTAGAGATGGG - Intronic
1098110688 12:67118468-67118490 GCATTGAGAAACCAAGAGCTGGG - Intergenic
1098913299 12:76232200-76232222 TCAAGGACAAAGCTGGTGCTGGG + Intergenic
1105250518 13:18695196-18695218 TCATGGACTGAGTTAGAGCTAGG + Intergenic
1105568882 13:21580379-21580401 GCATGGACAGAGCTAGCATTTGG + Intronic
1108845780 13:54677265-54677287 GCATTTACAAACCTTGAGCTAGG - Intergenic
1111652995 13:91116163-91116185 GCATGGACATAGCTAAAATTGGG - Intergenic
1113770372 13:112904357-112904379 GCAGGAACAAAGCCAGAGCGTGG - Intronic
1117727245 14:58687094-58687116 GCATTTACAAACCTTGAGCTAGG + Intergenic
1118005523 14:61561704-61561726 GCAGGGACAAAGCTAGCTCAGGG + Intronic
1118498352 14:66331512-66331534 GGATAAACAAAGCTAGAACTTGG - Intergenic
1118757320 14:68854261-68854283 GCAAGGGCAAAGCTGGAGCCAGG - Intergenic
1119173845 14:72554917-72554939 GCAGGGACAAATCCGGAGCTGGG - Intronic
1120183756 14:81371168-81371190 GCATGGTCAATGGTAGGGCTGGG + Exonic
1125595328 15:40881702-40881724 GCATTTAAAAAGCTAGGGCTTGG - Intergenic
1125681100 15:41530694-41530716 GGATGGACAGAGCCAGAGCTGGG + Intronic
1128932599 15:71718723-71718745 GCATGGACAAAGACAGAGGCAGG - Intronic
1129188937 15:73926655-73926677 GCATGGACAAAGCTAGAGCTGGG + Exonic
1130199723 15:81813726-81813748 GCATTCACAAAGCTACAGCAGGG - Intergenic
1131082754 15:89550647-89550669 GCAGGGACACAGATGGAGCTAGG + Intergenic
1131425879 15:92345180-92345202 GCATGGACAAAGCATGCGCATGG - Intergenic
1133396268 16:5449906-5449928 ATATGTACAAAGCTAGAGGTGGG - Intergenic
1138500677 16:57441663-57441685 ACATGGATAAAGTGAGAGCTGGG + Intronic
1140127650 16:72131514-72131536 GCAGCTACAAAGTTAGAGCTGGG + Intronic
1140720378 16:77766107-77766129 GCATGGAAAAAGGAAGAGCATGG + Intergenic
1141251612 16:82363928-82363950 GAATGGACCAAGGTAGAGTTGGG + Intergenic
1141817918 16:86425476-86425498 ACATGGACAAAGCCAGAGGCAGG + Intergenic
1144121441 17:12157771-12157793 GCATGGCCAGAGCAAGAGCAAGG - Intergenic
1147648085 17:42045965-42045987 GCAGGGACAAAGTAACAGCTTGG - Intronic
1148666947 17:49382136-49382158 GCATGGATGATGCCAGAGCTTGG + Intronic
1149190113 17:54050862-54050884 GTATTTACAAAGATAGAGCTTGG - Intergenic
1152702997 17:81828746-81828768 GCATGGACATAACTGGAGCCGGG + Intronic
1153486822 18:5607196-5607218 GCATGGTCAGAGTTATAGCTTGG + Intronic
1155829812 18:30499943-30499965 GCTAGTACAAAGCTAGAGATAGG - Intergenic
1159552060 18:69905478-69905500 GCAGGGACAAGGCTAGTTCTGGG - Intronic
1159655616 18:71028182-71028204 TAATGGACAAAGCCAGGGCTTGG + Intergenic
1162190669 19:8943843-8943865 GGATGGACAAATCTATAGGTAGG - Intronic
1164933788 19:32195833-32195855 GCTGGGACAAAGCTAGACCCAGG - Intergenic
1166704678 19:44902162-44902184 GGATGGACAAAGCTCCAGCTTGG - Intronic
1167616472 19:50537044-50537066 GCAAGGACAAGGCCAGAGCCAGG + Intronic
925170071 2:1744686-1744708 GCATGGCCAAGGCGAGCGCTCGG + Intronic
926733075 2:16051841-16051863 GCATGGACATAGAAAGATCTGGG - Intergenic
927887125 2:26725437-26725459 GCATGGACATAGCCCCAGCTTGG - Intronic
929595835 2:43175096-43175118 GCAAGCCCAAATCTAGAGCTTGG - Intergenic
929877502 2:45808889-45808911 GCATGAACAGAGCTATAGTTTGG + Intronic
930391484 2:50766866-50766888 ACATGGACAAAACAATAGCTGGG + Intronic
933050028 2:77591170-77591192 GCATTTACAAACCTTGAGCTAGG - Intronic
935719401 2:105966919-105966941 AAATGGCCAAAGCTAGAACTGGG - Intergenic
938141601 2:128799157-128799179 GCAAGGACAGACATAGAGCTGGG + Intergenic
938846613 2:135216295-135216317 GCATGGAAAAAGCTAGAGAAAGG + Intronic
939823642 2:146987364-146987386 GCTTGGACAATGCCAGAGATAGG + Intergenic
940654075 2:156467277-156467299 TCAGGGACAAAGCTAGAGTCTGG + Intronic
943365394 2:186963005-186963027 GCATTTACAAACCTTGAGCTAGG - Intergenic
946217320 2:218194687-218194709 TCAGGGACATAGCTGGAGCTGGG - Intergenic
1168999112 20:2154129-2154151 CCACAGAAAAAGCTAGAGCTTGG + Intronic
1169632658 20:7650356-7650378 TCAAGGAAAAAGCTAGAGGTTGG + Intergenic
1171455444 20:25269438-25269460 GCATGGAGTAAGCTGGTGCTGGG + Intronic
1172861153 20:38053369-38053391 GCTTGGAAAATGCTAGTGCTAGG - Intronic
1173732812 20:45340381-45340403 GCAACTAGAAAGCTAGAGCTGGG + Intronic
1174757163 20:53170824-53170846 TCTTGGGCAAGGCTAGAGCTGGG - Intronic
1176457348 21:6925742-6925764 TCATGGACTGAGTTAGAGCTGGG + Intergenic
1176835521 21:13790826-13790848 TCATGGACTGAGTTAGAGCTGGG + Intergenic
1177943734 21:27442500-27442522 GCATGGACAAAGGTTGGGGTGGG + Intergenic
1179451508 21:41471546-41471568 GCATGGAAAAGGCTAGAACAGGG - Intronic
1180800796 22:18631024-18631046 GCATGCACAGAGCTACAGCCTGG + Intergenic
1180852029 22:19026581-19026603 GCATGCACAGAGCTACAGCCTGG + Intergenic
1180988186 22:19917809-19917831 GCGTGGACATAGCTAGGCCTGGG - Intronic
1181220921 22:21364238-21364260 GCATGCACAGAGCTACAGCCTGG - Intergenic
1181431871 22:22886693-22886715 GCATGGGAAAACCCAGAGCTTGG - Intronic
1181572328 22:23774311-23774333 GCATGGTCAGTGCTGGAGCTGGG + Intronic
1183433438 22:37779843-37779865 TTAAGCACAAAGCTAGAGCTTGG - Intergenic
949524468 3:4889490-4889512 GCATGGAGAATGCCAGAACTGGG - Intergenic
951698315 3:25468820-25468842 GCAAGGACAAAGCTGCATCTGGG - Intronic
952037954 3:29226220-29226242 GCATGGAAACAGCTCTAGCTGGG - Intergenic
952057969 3:29473049-29473071 GCATTCACAAACCTTGAGCTAGG + Intronic
954230486 3:49213243-49213265 GCATTTACAAACCTTGAGCTAGG + Intronic
956189654 3:66596528-66596550 GCATGTACAAAGCTTCTGCTGGG + Intergenic
959256701 3:104024370-104024392 GCAGGGACACAGATGGAGCTGGG + Intergenic
959562909 3:107802830-107802852 GGATGTACAAGGCAAGAGCTTGG - Intronic
960040390 3:113144468-113144490 ACATGAACAATGGTAGAGCTGGG - Intergenic
960041050 3:113150180-113150202 GCATGGACAATCATACAGCTGGG + Intergenic
960319871 3:116221393-116221415 GAGTGGACAAGGCTATAGCTTGG - Intronic
961870512 3:129984386-129984408 GCATGAATGAAGGTAGAGCTGGG + Intergenic
962428880 3:135301282-135301304 TCATGGAGAAACCTAGAGCCAGG - Intergenic
964026185 3:152077831-152077853 GCATGGAGAGAGCCAGAACTTGG - Intergenic
964685102 3:159386761-159386783 TCATGGCCATAGCTAGAACTTGG + Intronic
965460428 3:168955325-168955347 GCATGGCCATGGCTAGAGCCAGG + Intergenic
965493854 3:169373792-169373814 CCATGGACAAATCTAGAACCTGG - Intronic
966458563 3:180146943-180146965 GCATGGACAAAGCAAGAGAGAGG - Intergenic
968331534 3:197874600-197874622 CCATGGACAGGGCTGGAGCTGGG - Intronic
969593255 4:8133682-8133704 GCATGGACCCAGGTGGAGCTGGG - Intronic
969797818 4:9539893-9539915 CCAGGGACAAAGCCAGAGCAGGG - Intergenic
971546269 4:27891049-27891071 GCATGGACCAAGCTGTACCTTGG - Intergenic
972220627 4:36950320-36950342 TCATGGCCCAAGCTATAGCTTGG + Intergenic
975331121 4:73114725-73114747 TCATGGACAAGTCTAGAGCTAGG + Intronic
975732971 4:77355671-77355693 GCATGTACAAAGCCAGTTCTTGG + Intronic
978076341 4:104535090-104535112 GCAGGTACAAAGCTACAGTTAGG - Intergenic
986830416 5:11571378-11571400 TTATGCACAAAGCTGGAGCTAGG - Intronic
988948319 5:36230262-36230284 GCAAGTACAAAGGAAGAGCTTGG - Intronic
989759139 5:44991007-44991029 GAATGGACAAACCTTTAGCTTGG + Intergenic
993712064 5:91235009-91235031 GCATGGAAAAAGCTATACCATGG - Intergenic
994239957 5:97407692-97407714 GCATTTACAAACCCAGAGCTAGG - Intergenic
996397099 5:123024452-123024474 AAATGGACAAACCTAGAACTAGG - Intronic
998908814 5:146935845-146935867 GCTTGGACTCAGATAGAGCTGGG + Intronic
1000018479 5:157299241-157299263 ACTTGGACAATGCTTGAGCTGGG - Intronic
1001476609 5:172055075-172055097 GTGTGGACAGAGGTAGAGCTTGG - Intronic
1003303476 6:4905677-4905699 GCATGCAGAAAGCCAGTGCTGGG - Intronic
1003485104 6:6568850-6568872 GCATGGACAAAGGTGGAGGTGGG + Intergenic
1003842905 6:10140679-10140701 GCATGAACTAACCTAGAACTCGG - Intronic
1003881289 6:10482393-10482415 GCATTTACAAACCTTGAGCTAGG + Intergenic
1005766429 6:29015856-29015878 GCATTTACAAACCTTGAGCTAGG - Intergenic
1007641683 6:43345678-43345700 ACATGGAAAAAAATAGAGCTTGG + Intronic
1008843982 6:55939445-55939467 GCAGGGACATAGATGGAGCTGGG + Intergenic
1011732734 6:90282449-90282471 GCAGGGACATAGATGGAGCTGGG - Intronic
1015719555 6:136227337-136227359 GCATGGGGAAAACTAGGGCTGGG - Intergenic
1016706261 6:147111614-147111636 ACATGGAGAAAGTTAGAGGTGGG - Intergenic
1021496709 7:21283148-21283170 CCAGGAACAAACCTAGAGCTGGG + Intergenic
1027353402 7:77334270-77334292 GCAGGGACACAGATGGAGCTGGG + Intronic
1029022174 7:97376313-97376335 GCAGGGACACAGATGGAGCTGGG + Intergenic
1034554207 7:151839712-151839734 CTATGGACAGAGCTAGAGCCTGG - Intronic
1035341506 7:158165533-158165555 GCATGAACAAAGAAAGAGCGAGG + Intronic
1041757417 8:61329974-61329996 GCATGGAGAAAGCTGAGGCTAGG - Intronic
1047850090 8:128847711-128847733 GAATGGAGAAAGCTACATCTTGG + Intergenic
1049254212 8:141605271-141605293 GCCTGGAGAAAGCCAGAGCCCGG + Intergenic
1052182060 9:25541726-25541748 ACATGGAGAAAGCTAGAGAAGGG + Intergenic
1052306795 9:27019333-27019355 GAATGGGCATGGCTAGAGCTGGG - Intronic
1053008074 9:34617270-34617292 TCATGGGCACAGCCAGAGCTAGG - Intronic
1058317609 9:103587734-103587756 GCATTGTCAAAGCAAGATCTGGG + Intergenic
1059814988 9:117902189-117902211 GCATGGACTAAGCTATATATGGG - Intergenic
1062627053 9:137448104-137448126 GCCTGGACAGAGTTGGAGCTAGG - Exonic
1186695147 X:12022600-12022622 GCATGGAGATACCTAGATCTGGG - Intergenic
1187491151 X:19752807-19752829 ACATACACAAAGCTAGTGCTTGG + Intronic
1187822017 X:23297896-23297918 GAATGGACAAAACAGGAGCTGGG - Intergenic
1191675314 X:63786517-63786539 GCATGGACAAAACAACAGGTTGG - Intergenic
1197713291 X:129687575-129687597 GCATGGATGAAGACAGAGCTGGG - Intergenic
1198107766 X:133477445-133477467 GCTTGGCCAAGGCTAGGGCTGGG + Intergenic
1201679601 Y:16629384-16629406 GCAGGAGCAAAGTTAGAGCTTGG + Intergenic
1202100487 Y:21303244-21303266 GCATTTACAAACCTTGAGCTAGG + Intergenic