ID: 1129190408

View in Genome Browser
Species Human (GRCh38)
Location 15:73934130-73934152
Sequence TCCAGCTGGCCCACAAGCAG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 238
Summary {0: 1, 1: 0, 2: 3, 3: 27, 4: 207}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1129190408_1129190417 24 Left 1129190408 15:73934130-73934152 CCCCTGCTTGTGGGCCAGCTGGA 0: 1
1: 0
2: 3
3: 27
4: 207
Right 1129190417 15:73934177-73934199 CAAATCTTTCTGCAAAAGAAAGG 0: 1
1: 0
2: 5
3: 28
4: 384

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1129190408 Original CRISPR TCCAGCTGGCCCACAAGCAG GGG (reversed) Intronic
900087665 1:906095-906117 TCCAGGAGGCCCAGAAGGAGCGG - Intergenic
900327425 1:2115586-2115608 TGCAGCTGGCTCTCAAGTAGGGG - Intronic
901399473 1:9006118-9006140 TCCAGGTGACACACAGGCAGTGG + Intronic
901634631 1:10664866-10664888 TGCAGCTGCCCCACACACAGTGG - Intronic
901640833 1:10692300-10692322 GTGTGCTGGCCCACAAGCAGAGG + Intronic
902157453 1:14499907-14499929 TCCAGCAGGCGCAGTAGCAGAGG + Intergenic
903849310 1:26296696-26296718 TTCAGAGGGCCCAAAAGCAGGGG + Intronic
904171386 1:28593990-28594012 TCCAGCAGGCCCTGCAGCAGGGG + Exonic
905150258 1:35921543-35921565 TCCAGCTGGCCTCCAAGCCTGGG - Exonic
905307843 1:37031834-37031856 TCCAGCTGGGGTTCAAGCAGGGG + Intronic
905625928 1:39490937-39490959 TCCAGCTGGGCCAGAAGCTCTGG - Intergenic
905819116 1:40976037-40976059 ACCATCTGGCCCAGACGCAGTGG - Intergenic
907108884 1:51908601-51908623 TCCTTCTCTCCCACAAGCAGAGG + Exonic
907110958 1:51925960-51925982 CTCAGCTGGCCCCCCAGCAGGGG - Intronic
907112033 1:51935321-51935343 TCCTGTGGGCCCACAAGAAGTGG - Intronic
910622682 1:89273655-89273677 TCGCGCTGGCCCTCAAGCACCGG + Intergenic
913117600 1:115711271-115711293 TCCACCTGCCACACAAGCAAGGG - Intronic
914830604 1:151168237-151168259 TGCGGCTGGCCCACAGGCCGAGG + Exonic
915555230 1:156657512-156657534 TCCATCTGGCCCTTGAGCAGAGG + Intronic
918128421 1:181604359-181604381 TCAAGCTTGCCCAGAAGAAGAGG - Intronic
918337104 1:183527640-183527662 TGGAGCCGGCCCACAAGAAGGGG - Intronic
923157264 1:231289805-231289827 TCCAGCTGGCCCGCAAGCGCCGG + Intergenic
1063165591 10:3459092-3459114 TCCAGCTGGCCTGCATGCTGAGG + Intergenic
1067235055 10:44440002-44440024 ACCAGATGGCCCAGATGCAGGGG + Intergenic
1068353862 10:55884554-55884576 TCCAGCTGGGCCAGGTGCAGTGG - Intergenic
1068373990 10:56155153-56155175 TCCAGCTGGCCAGCAAGCGCCGG - Intergenic
1069743347 10:70699591-70699613 TCCTTCTGGCCCACAATCATGGG - Intronic
1070750481 10:78961287-78961309 TCGAGCTGGGCCAAAACCAGTGG + Intergenic
1071273074 10:84026762-84026784 TGCAGCTGGCCCACAAGGCATGG + Intergenic
1071497935 10:86181291-86181313 TCCAGCTGCCCCTGAAGCTGTGG + Intronic
1073317736 10:102594616-102594638 TCCAGGTGGGCCACAGGGAGTGG - Intronic
1074314426 10:112348498-112348520 TCTAGCTGGCATATAAGCAGTGG + Intergenic
1074539074 10:114350110-114350132 TCCAGCTGGCTCCTAAGCTGGGG - Intronic
1074638801 10:115354053-115354075 TGCATGTGGCCCACAAGCTGCGG - Intronic
1075603334 10:123787033-123787055 TCCAGCTGGCCCAAAAACCGTGG + Intronic
1076817110 10:132920478-132920500 TCCAGCTGCCCTCCAAGCAGAGG + Intronic
1077392646 11:2307184-2307206 CCCTGCTGGCCCCCAAGCACAGG - Intronic
1078266459 11:9758916-9758938 GGCAGGCGGCCCACAAGCAGGGG + Intergenic
1079030042 11:16979925-16979947 CCCAGCTATCCCACAAGGAGTGG + Intronic
1079059974 11:17240077-17240099 CCCAGCTACCCCAGAAGCAGAGG + Intronic
1081192074 11:40116198-40116220 GCCAGCAGCACCACAAGCAGGGG + Exonic
1084045270 11:66564511-66564533 TCCAGCCAGGCCACAGGCAGGGG - Intronic
1085245571 11:75098237-75098259 TCCAGCTGGCCTGCAAGCGCAGG - Intergenic
1086397778 11:86433851-86433873 TCCAGCTGGCCCACAAGCGCCGG + Intergenic
1088628621 11:111752157-111752179 ACCAGCTGGCCTGCCAGCAGCGG + Exonic
1089733134 11:120532021-120532043 TCCACCTGCCCCACATCCAGAGG - Intronic
1089771632 11:120807340-120807362 TCCTGCAGACCCAGAAGCAGGGG + Intronic
1090972070 11:131652699-131652721 TCCCGCTGCCCAACAGGCAGGGG - Intronic
1093381535 12:18500177-18500199 TCCAGCCGGCCGGCAAGCACTGG - Intronic
1095444989 12:42274032-42274054 TCCAGCTGGCCCGCAAGCACTGG + Intronic
1095587382 12:43863930-43863952 TCTAGCTGGCCCGCAAGCGCCGG - Intronic
1096719126 12:53507989-53508011 TCCAAGAGGCACACAAGCAGAGG - Intronic
1097181859 12:57176178-57176200 TCCAAGTGGCCCCAAAGCAGAGG + Intronic
1097307418 12:58084967-58084989 CCCAGCTAGCTCACATGCAGAGG + Intergenic
1098515964 12:71376888-71376910 TCCAGCTGGCCCGCAAGCGCCGG - Intronic
1099395153 12:82129247-82129269 TCCAGCTGTTCCATAAGCTGAGG + Intergenic
1100761533 12:97812583-97812605 AGCAGCTGACCCACAAGCTGAGG - Intergenic
1102661786 12:114535300-114535322 TTCAGCTGGGCCACAAGTACTGG - Intergenic
1103592908 12:122004890-122004912 TCCAGCTGGACCCCACGTAGTGG - Intergenic
1103608873 12:122108863-122108885 TCCAGGAGGCCTTCAAGCAGGGG + Intronic
1103943959 12:124516171-124516193 TCCTGCTGGCCCAAGAGCGGAGG + Intronic
1104763673 12:131313213-131313235 TCCCGCAGGACCCCAAGCAGAGG - Intergenic
1106101172 13:26696000-26696022 TCCAGCTGGGCGACAGGGAGGGG - Intergenic
1109980475 13:69899905-69899927 TACAATAGGCCCACAAGCAGAGG + Intronic
1115634355 14:35277139-35277161 TCCAGCTGCCCGAGAGGCAGAGG - Intronic
1116452327 14:45080467-45080489 TCCAGCTGGCCCGCAAGCGCCGG - Intergenic
1117339312 14:54780225-54780247 TCCAGCTGGTTCACAACCAAGGG - Intronic
1117828551 14:59727542-59727564 GCCAGCTGGCCCACCGGCCGTGG + Exonic
1118690947 14:68339221-68339243 TTAAGCTGGCCCACAAGTACAGG - Intronic
1118888334 14:69885832-69885854 TTAAGCTGGCCCACAAGTACAGG - Intronic
1120935561 14:89892317-89892339 TCCAGCAGGCCCTGCAGCAGGGG + Intronic
1202904040 14_GL000194v1_random:58451-58473 TGCTGCTGGCCCAGAAGCAACGG - Intergenic
1126110808 15:45173662-45173684 TCCAGCTGTCCCACAGGTGGAGG + Exonic
1126229198 15:46305889-46305911 TCCAGCTGGCCTAGGTGCAGTGG + Intergenic
1126782058 15:52147449-52147471 TCCAACTTACCCACAAGCAATGG + Exonic
1128515981 15:68342207-68342229 CCCAGCTGGCAAACAAACAGTGG + Intronic
1129161489 15:73750522-73750544 TTGAGCTGGGCCTCAAGCAGTGG + Intronic
1129190408 15:73934130-73934152 TCCAGCTGGCCCACAAGCAGGGG - Intronic
1130790072 15:87144868-87144890 TCAGGCTGGCCCAGCAGCAGTGG + Intergenic
1131473660 15:92717602-92717624 TCCAGCTGGCAGACAAGGAGGGG + Intronic
1132653190 16:1030757-1030779 TCCAGCCGGCCCACACCCACTGG - Intergenic
1132670560 16:1100687-1100709 CCCAGCTGGTGCACCAGCAGTGG + Intergenic
1132721709 16:1319821-1319843 TCCAGCTGGGCCAGACTCAGGGG - Intronic
1133318539 16:4898940-4898962 TCCAGGCGGCCCACAGGCAGCGG + Intronic
1134177165 16:12016689-12016711 TGCAGATGGCCAACAAGCACAGG - Intronic
1134203213 16:12215913-12215935 TCCTGCTGGCCCATCAGGAGTGG + Intronic
1137294490 16:47077346-47077368 TTCAGCTGGGCCAGGAGCAGTGG + Intergenic
1138614792 16:58156859-58156881 TCCTGCTGTCCTACAGGCAGTGG + Intergenic
1138693633 16:58791115-58791137 TCCAGCTGGCCCAGAAGCGCCGG + Intergenic
1139301543 16:65949116-65949138 CCCAGCTGGTCCACAGGCTGAGG + Intergenic
1139825875 16:69756724-69756746 ACCAGCTGGCACAGGAGCAGGGG + Intergenic
1141174039 16:81707783-81707805 ACCAGCTGCCCCAGAAGGAGCGG + Intronic
1142212656 16:88815887-88815909 CTCAGCTGTCCCAGAAGCAGGGG + Intronic
1142414665 16:89934849-89934871 TCCAGCTGACCCACTCGCTGGGG + Exonic
1143298918 17:5894753-5894775 TCCAGATGGCCAATAAGCAATGG + Intronic
1144627046 17:16849350-16849372 CCCAGCTGGCCCAGCTGCAGGGG - Intergenic
1144879395 17:18423362-18423384 CCCAGCTGGCCCAGCTGCAGGGG + Intergenic
1145152845 17:20521025-20521047 CCCAGCTGGCCCAGCTGCAGGGG - Intergenic
1145781402 17:27566235-27566257 TCCAGCAGGCCCTGCAGCAGGGG - Intronic
1146225183 17:31059773-31059795 TGCAGCTGGCCTACAGGCATAGG + Intergenic
1146458473 17:33025310-33025332 TCCAGCTGGGGAACCAGCAGAGG + Intronic
1149058279 17:52390606-52390628 TCCTGCTGACCCACAAGCCCAGG - Intergenic
1151898786 17:76998001-76998023 TCCCGACGGCTCACAAGCAGGGG - Intergenic
1152569073 17:81113553-81113575 GACAGCAGGCCCACAAGGAGGGG - Intronic
1152677498 17:81648992-81649014 GCAAGCTGGCCCAGCAGCAGGGG - Intergenic
1157060653 18:44284998-44285020 CCCAGCTCACCCTCAAGCAGAGG + Intergenic
1161815299 19:6496079-6496101 TCCAGCTGACCCACTCGCTGGGG - Exonic
1166338944 19:42125851-42125873 TCAAGCAGACCCCCAAGCAGGGG - Intronic
1166719262 19:44988071-44988093 TCCAGCAGGGCCACCTGCAGGGG - Exonic
1166850115 19:45755902-45755924 TCCAGGAAGCCCAGAAGCAGGGG - Intronic
1167882468 19:52471531-52471553 TCCAGCTGGTGCAAAAGGAGGGG - Intronic
926806623 2:16717206-16717228 TCCAGCTGGTCCACAGCCTGTGG + Intergenic
927459355 2:23284647-23284669 TCCAGGAGGCTCTCAAGCAGAGG - Intergenic
928728777 2:34206670-34206692 TCCAGCTTGGCCACATGCACTGG + Intergenic
929070023 2:38020543-38020565 TCCAGCTGGCCCGCAAGCGCCGG - Intronic
929538558 2:42801369-42801391 TCCAACTGGCCCTGGAGCAGGGG - Intergenic
931296978 2:60936990-60937012 GCCAGCTGGCACAGAAGCAGGGG + Intergenic
932831952 2:74998774-74998796 TGCAGCAGGCCCACATGCACTGG - Intergenic
937939554 2:127274534-127274556 TCCAGCTTCCCCACAGGCAAGGG - Intronic
938313981 2:130314069-130314091 TGCTGCTGGTCCAGAAGCAGCGG - Intergenic
938778244 2:134560580-134560602 TCAAGCTGTCCCTAAAGCAGTGG - Intronic
940784630 2:157968200-157968222 TCGCGCTGGCCCACAAGCACCGG + Intronic
942075200 2:172351213-172351235 TACAGCTGTCCCACAAAGAGAGG + Intergenic
942317630 2:174709897-174709919 TCCAGCTGGCCCGCAAGCGCGGG + Intergenic
943361250 2:186922031-186922053 CCCAGCTGTCCAACAAGGAGAGG - Intergenic
945134901 2:206616641-206616663 TCCAGCTGGCCCTCAGTCGGTGG + Intronic
946325495 2:218982719-218982741 CCCAGCTGGACCACATCCAGAGG + Intronic
947411959 2:229850749-229850771 TCCAGCTGGCCCGCAAGCGCCGG - Intronic
948157061 2:235792131-235792153 TCCAGCTTTCCCAGTAGCAGAGG + Intronic
948656875 2:239481763-239481785 TCCAGCTGGGACCCAACCAGAGG - Intergenic
1169089517 20:2850086-2850108 CCCAGCTGACCCACCAGCATTGG - Intronic
1169105184 20:2988394-2988416 TCCAGCTTGTCCACGGGCAGGGG - Exonic
1172096076 20:32461117-32461139 TCCCTCGGCCCCACAAGCAGTGG + Intronic
1172186872 20:33036447-33036469 CCCATCTGGCCCACAGGCATGGG - Exonic
1172484684 20:35291185-35291207 TGCAGCTGGGCCTGAAGCAGGGG - Intronic
1173065355 20:39705387-39705409 TCCAGCTGCCAAACAGGCAGTGG - Intergenic
1173667808 20:44775203-44775225 TCCTGATGGACGACAAGCAGAGG - Intronic
1173841401 20:46159540-46159562 TCCAGCTGGGGCACAGGGAGGGG + Intergenic
1174174156 20:48634571-48634593 GGCAGCTGGCCCAGAGGCAGGGG + Intronic
1174257495 20:49268708-49268730 TACACATGGCCAACAAGCAGAGG + Intronic
1175157648 20:56982733-56982755 TCCAGCTTGGCCACATGCTGGGG + Intergenic
1175345338 20:58268944-58268966 CCAAGCTCGGCCACAAGCAGTGG + Intergenic
1176390586 21:6161112-6161134 TCCAGATGGCCCCCAGGCCGTGG - Intergenic
1176623412 21:9073218-9073240 TGCTGCTGGCCCAGAAGCAACGG - Intergenic
1178255957 21:31052857-31052879 TCCAGCTCTCCCACCAGAAGCGG + Intergenic
1178763671 21:35428813-35428835 ATCACCTGGCCCACAAGCAGCGG - Intronic
1179732881 21:43377127-43377149 TCCAGATGGCCCCCAGGCCGTGG + Intergenic
1180031193 21:45209506-45209528 TCCACCTGGCACACAGGCAAGGG - Intronic
1180207676 21:46272008-46272030 TCCAGCTTAACCACAAGCAGAGG + Intronic
1180999151 22:19979910-19979932 TCCAGCAGTGCCACAAGCAGCGG + Exonic
1181110517 22:20600225-20600247 TGCAGGCGACCCACAAGCAGAGG - Intergenic
1181566563 22:23742352-23742374 TCCAGGTGGGACACAAGCAATGG + Exonic
1181713593 22:24707316-24707338 TCCTGCTGGCCACCAGGCAGGGG - Intergenic
1181784138 22:25214045-25214067 TGCACCTGGCCCAAAAGCAAAGG - Intergenic
1182360046 22:29740948-29740970 TCCAGCTGCCCCCCATGCTGGGG + Intronic
1184403294 22:44286223-44286245 TCCTGCTGGACCAAGAGCAGAGG + Intronic
1185080236 22:48705572-48705594 TGCCGCTGGACCACAGGCAGTGG - Intronic
949769961 3:7568629-7568651 TCCAGCTGGCCCGCAAGCGCCGG - Intronic
953002857 3:38951183-38951205 TCCAGCTGGCCCGCAAGCGCCGG - Intergenic
954145319 3:48631554-48631576 TCCAGCTGGCCCTCAAATACAGG + Intronic
955442768 3:58974807-58974829 TTCACCTGGCCCAGTAGCAGTGG - Intronic
956632590 3:71331229-71331251 GCCAGCTGGCCCGCAAGCCTGGG + Intronic
960141983 3:114159713-114159735 TCCAGGTGGCCCAAAAGCTGGGG - Intronic
960282104 3:115791593-115791615 TCCAGCTGGCCCGCAAGCGCCGG - Intergenic
962758219 3:138484680-138484702 TCCAGCTGGCCCGCAAGCACCGG - Intergenic
968274312 3:197428257-197428279 TCCAGCTGATGCACACGCAGGGG + Intergenic
968572515 4:1349479-1349501 CCCAACTGCCCCACACGCAGAGG - Intronic
968590829 4:1458914-1458936 TCCAGGTGGCCCAGTAGAAGGGG + Intergenic
973329555 4:48898546-48898568 TCCAGTTGGCCCAATAGCTGTGG + Intronic
974173142 4:58292951-58292973 TTCAGCTTGCCCACAGGTAGTGG + Intergenic
974907745 4:68078157-68078179 TCCAGCTGGACCAGGATCAGGGG - Intronic
975298791 4:72765930-72765952 TCCTGCTGGCCTGCAAGCACCGG - Intergenic
975319827 4:72997251-72997273 TCCAACTGGGTCACAAGCAAAGG + Intergenic
975754795 4:77561919-77561941 TTGTGCTGGCCCACAAGCACTGG - Intronic
976442176 4:85088430-85088452 TCGAACTGGGCAACAAGCAGGGG + Intergenic
977562349 4:98545214-98545236 GCAAGCTTGCCCCCAAGCAGTGG - Intronic
981146806 4:141333522-141333544 TCCAGCTGGCCCGCAAGCGCCGG + Intergenic
983052945 4:163069871-163069893 TCCAGCAGGCCCCCAATAAGGGG - Intergenic
983905426 4:173176539-173176561 TGCATCTGGCCCACAAACTGTGG - Intronic
985967934 5:3351906-3351928 CCAAGCTGGCCACCAAGCAGGGG + Intergenic
986912420 5:12574273-12574295 TCCAGCTGGCCCGCAAGCGCCGG + Intergenic
987090408 5:14504529-14504551 TCGAGGAGGCCGACAAGCAGGGG - Exonic
987196400 5:15530810-15530832 CCCAGCTGGCCCCAAAGCATGGG - Intronic
992530603 5:77648289-77648311 TCCAGCTACCCAACATGCAGAGG - Intergenic
992717881 5:79529582-79529604 TTAAGCTGGCCCACAAGTACAGG + Intergenic
993822003 5:92631365-92631387 TCCAGCTGGCCCGCAAGCGCCGG - Intergenic
995316537 5:110781011-110781033 TCCTGCAGGCCCACAAACATTGG + Intergenic
996535246 5:124570751-124570773 CCCAGCTGGCCCACGTGCTGGGG - Intergenic
997120110 5:131164945-131164967 TCCAGCGGGCCCCCAGCCAGCGG - Intronic
998132513 5:139658567-139658589 TGCGGCTGGCCCACAGGCACAGG + Intronic
999327141 5:150650368-150650390 TCCATCTGGCCCTCAAGGAGGGG - Exonic
1000609117 5:163355889-163355911 TCGCACTGGCCCACAAGCACCGG - Intergenic
1002926104 6:1606563-1606585 TCCACCTGGCCCAGGAGCTGGGG - Intergenic
1004261411 6:14110848-14110870 ACCAGCAGGCACACAAGAAGGGG + Intergenic
1004262279 6:14118381-14118403 ACCTGCTGGCCCACAACCACAGG - Intronic
1004906184 6:20239095-20239117 TCGCGCTGGCCCACAAGTACCGG - Intergenic
1008017073 6:46532467-46532489 TGCAGCTGGCCTACAAGAACAGG + Intergenic
1015438849 6:133223856-133223878 TCCAGCTGGTCCAAATGCTGTGG - Intergenic
1015665725 6:135626357-135626379 TCCAGCTGACCCAGAAGCCCAGG + Intergenic
1018028286 6:159822466-159822488 ACCAGCTGGGCCACAGGGAGAGG - Intergenic
1018579379 6:165295534-165295556 TCCAGCTGGCAAAAATGCAGAGG - Intronic
1019817321 7:3210782-3210804 CCCAGATGGCCCACACTCAGTGG - Intergenic
1024251678 7:47510180-47510202 GCCAGCAGGCCCACAAGCTATGG + Intronic
1024880731 7:54082667-54082689 TACAGCTAGGCCACACGCAGTGG + Intergenic
1029024454 7:97401352-97401374 TCAACCTGGCACACAAACAGAGG + Intergenic
1030024661 7:105311522-105311544 TCCACCTGGCCAACAAGCAAAGG + Intronic
1032516279 7:132508580-132508602 CCCCGCTGTCCCAGAAGCAGCGG - Exonic
1033606350 7:142930854-142930876 TTCAGCAGGCCCAGGAGCAGGGG - Intronic
1033761116 7:144437703-144437725 TCTACCTGGCCAACAAGTAGTGG + Intergenic
1034429549 7:151034309-151034331 ACCAGCTGGCCCAGGAGCAGGGG - Exonic
1034632168 7:152539188-152539210 TCCAGCTGGCCCGCAAGCGCTGG + Intergenic
1034901670 7:154911547-154911569 CCCAGCTGCCACTCAAGCAGAGG + Intergenic
1037765415 8:21769471-21769493 TCCAGCTGCCCTGCAAGCACTGG - Intronic
1041114347 8:54520248-54520270 TCCAGCTGTCCCATAGGGAGGGG - Intergenic
1046288872 8:112132724-112132746 TCCAGCTGGCCTGCAAGCGCCGG - Intergenic
1047769474 8:128019117-128019139 TTCAGCTGGTCCAGACGCAGTGG - Intergenic
1053572183 9:39320686-39320708 TCCTCCTGGCCTACAAACAGTGG - Intergenic
1053623579 9:39845222-39845244 TCCTCCTGGCCTACAAACAGTGG - Intergenic
1053881290 9:42598006-42598028 TCCTCCTGGCCTACAAACAGTGG + Intergenic
1053891376 9:42696307-42696329 TCCTCCTGGCCTACAAACAGTGG - Intergenic
1054093740 9:60879397-60879419 TCCTCCTGGCCTACAAACAGGGG - Intergenic
1054115220 9:61155321-61155343 TCCTCCTGGCCTACAAACAGTGG - Intergenic
1054124962 9:61298325-61298347 TCCTCCTGGCCTACAAACAGTGG + Intergenic
1054220321 9:62405477-62405499 TCCTCCTGGCCTACAAACAGTGG + Intergenic
1054230394 9:62503695-62503717 TCCTCCTGGCCTACAAACAGTGG - Intergenic
1054592536 9:67027221-67027243 TCCTCCTGGCCTACAAACAGTGG + Intergenic
1061625840 9:131840247-131840269 TCCAGCTGCCCCACTGGCTGTGG - Intergenic
1062293089 9:135806253-135806275 TCCAGCTGGCCCACTTGTACTGG + Intergenic
1203746596 Un_GL000218v1:43646-43668 TGCTGCTGGCCCAGAAGCAACGG - Intergenic
1186334378 X:8570681-8570703 TCCATCTGCCCCACCAGCACCGG - Exonic
1192458609 X:71298740-71298762 ACCAGCTGGCACAGGAGCAGGGG - Exonic
1194321029 X:92446769-92446791 TCGAGCTGGGTAACAAGCAGGGG + Intronic
1196022231 X:111002508-111002530 TCCAGCTGCCCCACATGCTTCGG - Intronic
1199342473 X:146697718-146697740 TCCATGTGGCCCACAGGCTGCGG + Intergenic
1200002360 X:153068636-153068658 TTCAGCTGGCCCCAAAGCACAGG - Intergenic
1200005364 X:153081374-153081396 TTCAGCTGGCCCCAAAGCACAGG + Intergenic
1200215982 X:154368502-154368524 TCCAGCTGGCCCAGAATCCAGGG + Intronic
1201159923 Y:11158660-11158682 TGCTGCTGGCCCAGAAGCAACGG - Intergenic