ID: 1129190424

View in Genome Browser
Species Human (GRCh38)
Location 15:73934255-73934277
Sequence CAGTGCCACCAGACGTTTTA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 58
Summary {0: 1, 1: 0, 2: 0, 3: 3, 4: 54}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1129190420_1129190424 16 Left 1129190420 15:73934216-73934238 CCAGACCCTGCTTGACAATGAAG 0: 1
1: 0
2: 1
3: 10
4: 132
Right 1129190424 15:73934255-73934277 CAGTGCCACCAGACGTTTTATGG 0: 1
1: 0
2: 0
3: 3
4: 54
1129190421_1129190424 11 Left 1129190421 15:73934221-73934243 CCCTGCTTGACAATGAAGTCTGT 0: 1
1: 0
2: 0
3: 12
4: 145
Right 1129190424 15:73934255-73934277 CAGTGCCACCAGACGTTTTATGG 0: 1
1: 0
2: 0
3: 3
4: 54
1129190422_1129190424 10 Left 1129190422 15:73934222-73934244 CCTGCTTGACAATGAAGTCTGTG 0: 1
1: 0
2: 1
3: 6
4: 159
Right 1129190424 15:73934255-73934277 CAGTGCCACCAGACGTTTTATGG 0: 1
1: 0
2: 0
3: 3
4: 54

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1129190424 Original CRISPR CAGTGCCACCAGACGTTTTA TGG Intronic
901937236 1:12635323-12635345 CAGTCCCTCCAGAGGTTCTAGGG - Intergenic
903864202 1:26386364-26386386 CAGTGTCAGCAGAAGTCTTAGGG + Intergenic
905418998 1:37826113-37826135 TAGTGCCAACATACGTTTTAAGG + Intronic
908676370 1:66608751-66608773 CAGTGCCTCCTCCCGTTTTAAGG - Intronic
917665919 1:177225563-177225585 CAGTTCCACCAGAAGTTGTGAGG + Intronic
919027363 1:192193279-192193301 CAGTGTCACCAGCCATTGTAAGG + Intergenic
921761138 1:218916551-218916573 CAGAGTCACCAGAAGTTTAAGGG + Intergenic
922175277 1:223192689-223192711 CAGGGCCACCTAAGGTTTTAGGG + Intergenic
1063778341 10:9290861-9290883 CAGTGCCATAAGACCTTTTATGG - Intergenic
1067456532 10:46423184-46423206 AAGAGCCACCAGACACTTTAGGG - Intergenic
1067630668 10:47961455-47961477 AAGAGCCACCAGACACTTTAGGG + Intergenic
1069251437 10:66272015-66272037 CAGTGCCAGCAGGCGTTCCAAGG + Intronic
1070044811 10:72822358-72822380 CAATGCCACCACACATTCTATGG + Intronic
1080876634 11:36280599-36280621 CAGTGTCAACAGATGTTTCAAGG + Intronic
1092617805 12:10231592-10231614 CTCTGCCATCAGACGTTTTTGGG - Intergenic
1095214849 12:39536321-39536343 CAGTGCCACCAGAGTTTCTGTGG - Intergenic
1097986840 12:65792415-65792437 CAGTGCCAGAAAACGTTATAAGG + Intergenic
1103731489 12:123030806-123030828 CAGTGCCTCATTACGTTTTATGG - Intronic
1106717941 13:32410233-32410255 CAGCACCACCAGACGTGTGAAGG - Intronic
1129190424 15:73934255-73934277 CAGTGCCACCAGACGTTTTATGG + Intronic
1131191911 15:90323695-90323717 CACTGCCTCCAGTAGTTTTAGGG - Intergenic
1139661983 16:68427422-68427444 CAGAGCCTCCAGATGTCTTAGGG - Intronic
1140564359 16:76023796-76023818 CAGTACCAACAAACGTTTTATGG + Intergenic
1141482506 16:84315938-84315960 CAGGGCCACCAGGCCTTTAAGGG + Intronic
1144271531 17:13621941-13621963 GAGTTCCAGCAGAAGTTTTAGGG - Intergenic
1151047631 17:70940337-70940359 TAGTGCCACCAGACTTATCATGG - Intergenic
1157619541 18:49008434-49008456 CAGGGCCACCAGCCATTTTTGGG - Intergenic
1159053766 18:63445366-63445388 CAGTTCTCCTAGACGTTTTATGG + Intergenic
1159843585 18:73430148-73430170 CAGAGCCATCAGATATTTTATGG - Intergenic
929823870 2:45295029-45295051 CAGTGCCCCCAGACCTTGGAGGG - Intergenic
930029955 2:47052313-47052335 CATTGCCACCAGGCGTCTGAAGG + Intronic
933393782 2:81706164-81706186 CAGTCTCACCAGACATTTTCTGG + Intergenic
948983551 2:241507343-241507365 CTGTCCCACCAGACGCTTAAAGG + Intronic
1170115928 20:12859411-12859433 CAGTTCCACCATACGCTGTAGGG + Intergenic
1175888750 20:62306802-62306824 CAGAGCCAGCAGAAGTTTAAAGG - Intronic
1183306779 22:37086984-37087006 CAGTGTCACCAGTCTTTTCAGGG - Intronic
954905311 3:54057269-54057291 CAGGGCCTCCAAACCTTTTAGGG + Intergenic
956209893 3:66791820-66791842 CAGTGCTTCCAGATGTTTTCTGG + Intergenic
956635402 3:71359175-71359197 CAGTGACCCCAGGCTTTTTATGG - Intronic
963945010 3:151136053-151136075 CTGTGCCACCTGAGGTTTTGTGG + Intronic
979908932 4:126335200-126335222 CAGTGGCCACAGACGTTTTTGGG + Intergenic
982100579 4:151963637-151963659 TAGTTCTACCAGAGGTTTTAGGG + Intergenic
985139382 4:186823115-186823137 CAGTGCAACCAAATTTTTTAGGG + Intergenic
986452433 5:7880096-7880118 CAGTGCCAGCACAATTTTTAGGG - Intronic
1001769444 5:174282118-174282140 CAGGGCAACCATATGTTTTAGGG - Intergenic
1016596591 6:145809410-145809432 CAGTGCTCTCAGAAGTTTTAGGG + Intronic
1017718536 6:157228809-157228831 CAGAGCCACCAGACATTTCCTGG + Intergenic
1020507127 7:9005200-9005222 CAGTGCCTTCTGACGTTTAAGGG + Intergenic
1021516093 7:21489067-21489089 CAGTTGCACAAGACTTTTTAGGG - Intronic
1024150792 7:46569497-46569519 CAGTGCAACAAAACCTTTTAAGG + Intergenic
1026945985 7:74316537-74316559 CACTGCCCCCAGCCCTTTTAGGG + Intronic
1027997677 7:85446593-85446615 TAGTGCCACTAGATGTTTTTTGG + Intergenic
1050827577 9:9968328-9968350 CAGTGCAAAATGACGTTTTAGGG - Intronic
1053048921 9:34942295-34942317 CAGTGCCAGCAGACTTCTTTGGG - Intergenic
1060356553 9:122913884-122913906 CAGAGTAACCAGACCTTTTATGG + Intergenic
1185484854 X:474568-474590 CAGTCCCTCCAGAGGTTCTAGGG + Intergenic
1187616618 X:21001325-21001347 CATTGTCACAACACGTTTTAAGG + Intergenic
1190728109 X:53204854-53204876 CAGTGGCACCAGGCATTCTAGGG - Intronic