ID: 1129193446

View in Genome Browser
Species Human (GRCh38)
Location 15:73951111-73951133
Sequence CAGGAAACAAAGGAGGCTGC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 538
Summary {0: 1, 1: 0, 2: 4, 3: 51, 4: 482}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1129193436_1129193446 16 Left 1129193436 15:73951072-73951094 CCATTCTAGGGAAGGAGGAGGAA 0: 1
1: 0
2: 6
3: 39
4: 322
Right 1129193446 15:73951111-73951133 CAGGAAACAAAGGAGGCTGCTGG 0: 1
1: 0
2: 4
3: 51
4: 482

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1129193446 Original CRISPR CAGGAAACAAAGGAGGCTGC TGG Intronic
900769403 1:4528789-4528811 CAGGTGACAGAGGAGGCAGCAGG - Intergenic
900802444 1:4745740-4745762 GTGGAGTCAAAGGAGGCTGCTGG + Intronic
901528838 1:9841288-9841310 GAGGAACAAAAGGAGGCTGGTGG + Intergenic
902128043 1:14233890-14233912 CAGGAAACAACAGATGCTGGAGG + Intergenic
903129271 1:21268132-21268154 CAGAAGACAATGGAGGCAGCAGG + Intronic
903619594 1:24688330-24688352 GAGGAAACAGAGGAGGCTGAGGG - Intergenic
903659414 1:24967587-24967609 TAAGAAACAAAGCAGGCTTCAGG - Intergenic
903705819 1:25284995-25285017 CAGGAAAGAAAGGATGCAGGAGG - Intronic
903721419 1:25408424-25408446 CAGGAAAGAAAGGATGCAGGAGG + Intronic
904889038 1:33764204-33764226 TGGGTCACAAAGGAGGCTGCTGG - Intronic
905174201 1:36125815-36125837 CAGGCCACCGAGGAGGCTGCGGG + Intergenic
905734714 1:40317153-40317175 GAGGAGAACAAGGAGGCTGCGGG + Exonic
905831146 1:41068926-41068948 CAAGAAACTAAGAAGGCTCCAGG + Intronic
908007712 1:59743825-59743847 ATGGACAGAAAGGAGGCTGCAGG - Intronic
910701202 1:90076500-90076522 CAGGAAACAACAGATGCTGGAGG + Intergenic
912127685 1:106560106-106560128 CAGGAAACAACAGATGTTGCAGG + Intergenic
913426903 1:118741965-118741987 CAGGCAACAAGGGTGCCTGCCGG + Intergenic
913486793 1:119339280-119339302 CAGGAAAAAATGAATGCTGCTGG - Intergenic
913571527 1:120125006-120125028 CAGGAAACAATGAAAGCTCCAGG - Intergenic
913699884 1:121364289-121364311 AAGGAAAGAAAGGAGGAAGCAGG - Intronic
914137657 1:144915748-144915770 AAGGAAAGAAAGGAGGAAGCAGG + Intronic
914292448 1:146286627-146286649 CAGGAAACAATGAAAGCTCCAGG - Intergenic
914358433 1:146909080-146909102 CAGGAAAAAAAGAAGGCTAGAGG - Intergenic
914494992 1:148187927-148187949 CAGGAAAAAAAGAAGGCTAGAGG + Intergenic
914553492 1:148737410-148737432 CAGGAAACAATGAAAGCTCCAGG - Intergenic
915325830 1:155080760-155080782 GAGGACAGAAAGGAGGCTCCCGG - Intronic
916165014 1:161958891-161958913 CAGGTAACACTGGAGGATGCAGG - Exonic
916853152 1:168724582-168724604 TAGGAAACAAAGCAGGCTGAGGG + Intronic
918185409 1:182122326-182122348 GAGGAATCAGAGGAGGCTCCTGG - Intergenic
918322279 1:183375603-183375625 CAGGAGATAGGGGAGGCTGCAGG - Intronic
918453697 1:184685645-184685667 CAGGAAAAAGAGAAGGCTCCTGG - Intergenic
918703571 1:187635429-187635451 TAGGACACAAAGGAGGCGGGGGG + Intergenic
919266431 1:195273057-195273079 CAGATAACAAACGAGGATGCAGG + Intergenic
919803593 1:201367770-201367792 GAGGAAGCAAAGGAGGCTGAAGG - Exonic
920306253 1:205020062-205020084 CAGAGCACAAAGGAGGGTGCTGG - Exonic
920409898 1:205750721-205750743 CAGGGACCAAATGAGGCTGCTGG + Intergenic
920487298 1:206382998-206383020 AAGGAAAGAAAGGAGGAAGCAGG - Intronic
921288993 1:213637105-213637127 CAGGAAACAACAGATGCTGGAGG + Intergenic
921561365 1:216662465-216662487 CAGAAAACAATGGAAGCTCCTGG + Intronic
921755107 1:218846385-218846407 CAGGAAACAAGAGATGCTGGAGG + Intergenic
922558370 1:226549597-226549619 CGCGAACCAAAGGGGGCTGCAGG - Intronic
923055762 1:230425458-230425480 CCGGAAACAAATGAGGCTGCAGG - Intronic
923645299 1:235814549-235814571 CAGGAAAGAAAGGAGTCAGCAGG + Intronic
923810047 1:237304303-237304325 CAGAAAACAAAAGAAGCTGAAGG - Intronic
924439541 1:244074731-244074753 CAGGAGAAAAAAAAGGCTGCAGG - Intergenic
924643935 1:245859652-245859674 CTGGAGACCAAGGAGGGTGCAGG + Intronic
1063706625 10:8437187-8437209 CAGGAACCAAAGAAGGCTTCAGG - Intergenic
1063782464 10:9341644-9341666 CTGGAATCACAGGAGTCTGCCGG - Intergenic
1063998503 10:11643109-11643131 CATGGAACATCGGAGGCTGCTGG + Intergenic
1064549163 10:16481250-16481272 CAACAAACAAAGCAGGCTTCTGG - Intronic
1065568322 10:27040731-27040753 CAAGAAACAAAGGAAGTGGCCGG + Intronic
1065999847 10:31094123-31094145 CAGGAAACAAATGACTTTGCTGG + Intergenic
1066172237 10:32861907-32861929 CAGGAAACAACAGATGCTGGAGG + Intronic
1068905412 10:62316774-62316796 CAGGAGACAAAGGAGGATGGGGG - Intergenic
1069848898 10:71392353-71392375 TAGGAACAAAAGGAGGCTGGTGG + Intergenic
1069964287 10:72101382-72101404 AAGGAAACAAGGGATGCTGAGGG + Intronic
1070930428 10:80256966-80256988 CAGGCAGCGAGGGAGGCTGCTGG - Intergenic
1072005554 10:91243184-91243206 CAGGAGACTAAGGAGGTTGTGGG + Intronic
1072686974 10:97543254-97543276 AAGGAAACCAGGGAGGATGCTGG + Intronic
1072997848 10:100262096-100262118 CAGGAAACAAATGGGCCTGCCGG + Intronic
1073941462 10:108703496-108703518 CATGAATCAGAGGAGGCTGTAGG + Intergenic
1073942023 10:108710461-108710483 CAGGAAACACAGGATCCTGAAGG - Intergenic
1075008194 10:118845531-118845553 CAGGGGACCAAGCAGGCTGCCGG + Intergenic
1075041835 10:119114188-119114210 CAGGAAGCAGAGGAGGCGGCTGG - Intronic
1075650919 10:124128077-124128099 CAGGGACCAGGGGAGGCTGCAGG - Intergenic
1076500601 10:130933347-130933369 CTGGACACAATGGAAGCTGCAGG - Intergenic
1076907371 10:133369776-133369798 GAGGCAGGAAAGGAGGCTGCTGG + Intronic
1077299136 11:1839138-1839160 CAGGCCCCAAAGGGGGCTGCTGG - Intronic
1078155647 11:8797744-8797766 CAGGAAAAAGAGTAGGGTGCTGG - Intronic
1079331297 11:19535193-19535215 CAGGGAAAACAGGAAGCTGCTGG + Intronic
1079412525 11:20202416-20202438 CAGTAAACAAACTTGGCTGCAGG + Intergenic
1079918098 11:26396280-26396302 CAGGAAACAACAGATGCTGGAGG + Intronic
1080289687 11:30656720-30656742 CAGGGAACAAAGGAAACTTCAGG + Intergenic
1082762646 11:57142462-57142484 CAAGAAACAAAGCAGGAAGCTGG + Intergenic
1083424326 11:62575338-62575360 CAGCAAACCAAGGAGGGAGCTGG - Exonic
1084004447 11:66315617-66315639 CAGGGATCACAGGAGGCTGGTGG + Exonic
1084297564 11:68222734-68222756 AAGGAAACACAGGAGGCAGAAGG - Intergenic
1084625909 11:70306864-70306886 CTGGAAACAAAGAAGGCTCAGGG - Intronic
1084735815 11:71104620-71104642 TCAGAAACAAAGGAAGCTGCGGG - Intronic
1084915467 11:72425913-72425935 CAGGAAACTACAGGGGCTGCAGG - Intronic
1085253922 11:75161669-75161691 CATGAAACAATGGAGGCTTCCGG + Intronic
1085691967 11:78671402-78671424 CAGGAAACAAAGCAGGGATCTGG + Intronic
1086329373 11:85738237-85738259 AAGAAAAGAAATGAGGCTGCAGG - Intronic
1086530972 11:87784729-87784751 CAGGAAACAAAAGATGCTGGAGG + Intergenic
1086812378 11:91326500-91326522 CAGGAAACACAAGTGGCAGCTGG - Intergenic
1087038799 11:93778805-93778827 CAGGAAACAACAGGTGCTGCTGG - Intronic
1088308690 11:108437343-108437365 AAGGAAGCAAATAAGGCTGCAGG + Intronic
1088694438 11:112354919-112354941 CAGGAAACAAAGCAGGGTGAAGG - Intergenic
1088811109 11:113393258-113393280 CAGGAAGTAAAGGAGTTTGCAGG - Intronic
1088982498 11:114876341-114876363 CAGAAATCAAAGGAGGCTACTGG + Intergenic
1089503802 11:118949749-118949771 CAGGAAACAACAGATGCTGGAGG - Intronic
1091646679 12:2277532-2277554 CAGAAATCTAAGGAGGCTTCAGG + Intronic
1091859350 12:3765448-3765470 GAGGAAAGCAAGGATGCTGCAGG + Intergenic
1092099077 12:5868615-5868637 TAGGAAAAAAGGGAGGATGCTGG - Intronic
1092316132 12:7416075-7416097 CAGGAAACAACAGATGCTGGAGG - Intronic
1093090339 12:14913298-14913320 CAGGATCCAAAGGAGCCTTCTGG + Intergenic
1093361558 12:18235498-18235520 CAGGAAACAACAGATGCTGGAGG - Intronic
1095107271 12:38249761-38249783 CAGAAAACAAAAGAGGCTGCCGG - Intergenic
1095434631 12:42174001-42174023 CAGGAAACAAAGGAGGTCAGTGG - Intronic
1095452533 12:42347911-42347933 AAGGAAACAAAGATGACTGCAGG - Intronic
1095455592 12:42382009-42382031 TAGGAAAAAAAGGACACTGCAGG - Intronic
1096041243 12:48519629-48519651 CAGGAAACAACAGATGCTGGAGG - Intronic
1096256050 12:50063080-50063102 CAGGAAGAAAAGGAGGTGGCCGG - Intronic
1096653908 12:53076569-53076591 CATCAGACACAGGAGGCTGCTGG - Intronic
1096807909 12:54151539-54151561 CTGCCAACAAAGGAGGCTGTTGG - Intergenic
1097125618 12:56772209-56772231 AAGTAAAAACAGGAGGCTGCTGG - Intronic
1099189454 12:79547542-79547564 AAGGAAACAAAGAAGGGTGGGGG + Intergenic
1099905061 12:88761677-88761699 CCAGAAAAAAAGGGGGCTGCAGG + Intergenic
1100450571 12:94701916-94701938 TAGGAAACAACAGAGGGTGCTGG + Intergenic
1101032962 12:100677970-100677992 CAGGAAGCAAAGGTGGAAGCAGG - Intergenic
1101212789 12:102551396-102551418 GAGGTAACAGAGGAGGCTGAAGG + Intergenic
1101472176 12:105008149-105008171 CAGGAAACAACAGATGCTGGAGG - Intronic
1103013391 12:117475331-117475353 CAGGAAAAAAATTAGGCTGGGGG - Intronic
1103862737 12:124027377-124027399 AGGGAAATGAAGGAGGCTGCTGG - Intronic
1103995531 12:124827633-124827655 CAGGATAGCAAGGAGGCTGTGGG - Intronic
1104332349 12:127858568-127858590 CATGAAACCAAGGAGACTACAGG + Intergenic
1104622801 12:130331099-130331121 CAGGAACCAAAGGAGGGTACGGG + Intergenic
1104667165 12:130655932-130655954 CAGGAGTGAAAGGAGGATGCTGG + Intronic
1104676127 12:130713744-130713766 CCGGACACAAAGGAAGCTCCCGG + Intronic
1104894477 12:132155062-132155084 CAGGAAATGAACGCGGCTGCCGG + Intergenic
1105219105 13:18309124-18309146 CAGGAAGCACATGTGGCTGCGGG - Intergenic
1106920604 13:34559182-34559204 CAGGAAAGATAGGTGGATGCTGG + Intergenic
1107832955 13:44390583-44390605 CAGGGCACAAAGGAGGCTGCAGG - Intronic
1108114541 13:47112398-47112420 CAGCAAACAAAGAAGCCTCCAGG + Intergenic
1109037320 13:57281926-57281948 CATCAAACTAAGGAGGCTTCTGG + Intergenic
1109385412 13:61623573-61623595 CAGGAAACAACAGATGCTGGAGG - Intergenic
1111255756 13:85666091-85666113 CAGGAAACAGAGGAGGCCTTAGG + Intergenic
1111276164 13:85950209-85950231 GAGTAAAATAAGGAGGCTGCAGG - Intergenic
1111628449 13:90818666-90818688 CAGGAAAAAACAGATGCTGCAGG + Intergenic
1111953967 13:94736667-94736689 TTGGAAACAATGGAGGCTGATGG - Intergenic
1112239129 13:97663748-97663770 CAGGCAAGAACTGAGGCTGCAGG + Intergenic
1113474623 13:110571730-110571752 CTGGAAATAAATGAGGCTGCGGG + Intergenic
1113931338 13:113970518-113970540 CAGTAAACACATGAGGCTCCGGG + Intergenic
1115274069 14:31587012-31587034 CGGAAAACAGAGGAGGCAGCTGG + Intronic
1115337007 14:32252196-32252218 AAGGAAACAAGGGAGCCTTCAGG - Intergenic
1115618585 14:35119743-35119765 TAGGAAAGAAAGGAGGAGGCTGG + Intronic
1117406873 14:55412207-55412229 CAGCAAACAAAGTAGGGTGAAGG + Intergenic
1118740619 14:68736988-68737010 CAGGAAACAAGGGAAGGTGAGGG + Intergenic
1119386281 14:74259790-74259812 CAGGACCCCAAGGAGGGTGCGGG - Intronic
1119387409 14:74266243-74266265 CAGGAGACACAAGAGGCTGGAGG - Intergenic
1122271708 14:100571207-100571229 CAGAAGATAAAGGTGGCTGCTGG - Intronic
1123189406 14:106553987-106554009 CAAAAAACAATGGATGCTGCTGG + Intergenic
1124992621 15:34691102-34691124 CAAGAAAGCAGGGAGGCTGCTGG - Intergenic
1126353705 15:47771979-47772001 CTGAAAACAAAGGAAGGTGCTGG + Exonic
1126358493 15:47821550-47821572 CTTGAAACAAATGAGCCTGCTGG + Intergenic
1126856824 15:52847061-52847083 GAGGAAAAAAAGGGGGCTGTAGG + Intergenic
1126912305 15:53429706-53429728 GAGGAAGCAAAGGAGGCTTTTGG + Intergenic
1127915736 15:63453400-63453422 CAGGAAAGCAGGAAGGCTGCAGG - Intergenic
1128378262 15:67092630-67092652 CAGGATACTGAGGAGGGTGCTGG + Intronic
1128681917 15:69658643-69658665 CAGGAAACAGAGAAGGCAGAAGG - Intergenic
1129193446 15:73951111-73951133 CAGGAAACAAAGGAGGCTGCTGG + Intronic
1129808346 15:78483552-78483574 AAGGAAAATAAGGGGGCTGCTGG - Intronic
1130119559 15:81035813-81035835 GAGGAAAGAATGGAGGATGCTGG - Intronic
1130122710 15:81065152-81065174 CAGGAGACAAACAAGGCTACAGG + Intronic
1130408300 15:83622989-83623011 CAGGAAGCAATGCAGGCAGCAGG - Intergenic
1131097531 15:89665951-89665973 CAGGACTCTAAGGCGGCTGCCGG - Intronic
1132097828 15:99000804-99000826 GAGAAAAAAAAGCAGGCTGCGGG + Intronic
1133099593 16:3471087-3471109 CTGGAAACAAATGAGGATACTGG + Intronic
1134236691 16:12471837-12471859 CAGGGCACAAAGGAGTCTTCTGG - Intronic
1134905004 16:17972476-17972498 CAGGGAGCCAAGGAGGCTGGAGG + Intergenic
1135424444 16:22325386-22325408 CAGGAAAGGAAGGAGGGTGAAGG - Intronic
1137442862 16:48511081-48511103 CAGGAAACAAAGCAGGATGGTGG - Intergenic
1137666690 16:50253853-50253875 CTGGAAGCAAAGGAGGCTCCAGG - Intronic
1138373194 16:56543538-56543560 GAGGGATCAAAGGAGCCTGCTGG + Intergenic
1138999801 16:62495826-62495848 AAGGAAACACAAGAGGCTGTGGG - Intergenic
1139039132 16:62982012-62982034 GAGGACACAAAGGAGGCTTTGGG + Intergenic
1139896856 16:70294652-70294674 CAGGAAACAAAGCCCTCTGCGGG + Intronic
1141094014 16:81149874-81149896 CATGAAAAACAGGTGGCTGCAGG + Intergenic
1141117868 16:81326056-81326078 CATGAACTAAAGGAGTCTGCTGG - Intronic
1141620548 16:85234885-85234907 AAAGAAACAAAGGCGGCTGCCGG + Intergenic
1141680295 16:85539882-85539904 CAGGGAACAAAGGAGAGTCCTGG + Intergenic
1141736108 16:85854672-85854694 CAGCATGCAAAGGAGGTTGCAGG + Intergenic
1141865099 16:86744896-86744918 GAGGACACAAAGGAGGCTTTGGG + Intergenic
1141892380 16:86935010-86935032 CAGGGAACTAAGGAAGCTGGTGG + Intergenic
1142004327 16:87682142-87682164 CAGGAAATGAAGCAAGCTGCTGG - Intronic
1142005073 16:87685762-87685784 GAGGAAACAAAACAGGCCGCAGG - Intronic
1142755648 17:2015070-2015092 AAGGCAAGACAGGAGGCTGCTGG + Intronic
1144051090 17:11497720-11497742 ATGGAAATAAAGGTGGCTGCTGG - Intronic
1144454031 17:15404487-15404509 CCGGAGACAGAGGAGACTGCAGG + Intergenic
1144459156 17:15443773-15443795 CAGAAAACAAAAAAGGCTCCGGG + Intronic
1144672585 17:17141326-17141348 CAGGAAGCTAAGGAAGCTGCTGG - Intronic
1145288164 17:21522002-21522024 CAGGAAAGCCAGGAGGCAGCAGG + Intergenic
1147722744 17:42548733-42548755 CAGGAGACAAAGGAGGGCGCGGG - Intergenic
1147987224 17:44313581-44313603 CAGGAACTGAAGGATGCTGCAGG - Intronic
1148153872 17:45411709-45411731 CAGGAATCACAGAAGGCTGGAGG + Intronic
1148340775 17:46872331-46872353 CATGTAACAAAGGTTGCTGCAGG - Intronic
1148815471 17:50324913-50324935 CTGAAAACCAGGGAGGCTGCTGG + Intergenic
1148815613 17:50325826-50325848 CTGAAAACCAGGGAGGCTGCTGG - Intergenic
1149352396 17:55804205-55804227 CAGGAAACAACAGATGCTGGAGG + Intronic
1149772086 17:59330690-59330712 CAGGAAACCAGGGAGGCACCAGG - Intergenic
1149813412 17:59700292-59700314 CAGTCTACAAATGAGGCTGCTGG + Exonic
1151675817 17:75596853-75596875 CAGGATACTCAGGAGGCTGTGGG - Intergenic
1151786682 17:76278623-76278645 CAGCCAACGAAGGAGGCTGGCGG - Intronic
1151932841 17:77243537-77243559 AAAAAAACAAAGGAGGCAGCAGG - Intergenic
1152008645 17:77697423-77697445 CATGAAAGAGAGGAGGCTCCTGG - Intergenic
1152234855 17:79133218-79133240 GAGAAGACAGAGGAGGCTGCAGG + Intronic
1152276396 17:79360324-79360346 CAGGGAACCAAGGAACCTGCAGG + Intronic
1152463078 17:80451409-80451431 CAGGAAGCCCAGGAGGCTGTGGG + Intergenic
1152622695 17:81373097-81373119 CAGGAAGGAAAGGAGGCCACTGG - Intergenic
1152856488 17:82667605-82667627 CAGGAGACAGAGGAGGATGCGGG - Intronic
1153770989 18:8416357-8416379 CAGGAAACAGTGGAGCCTGCAGG - Intergenic
1155700988 18:28743367-28743389 CAGGAAAGCAAGGAAACTGCAGG + Intergenic
1156457113 18:37301058-37301080 CAGGAGACACAGGAGGAGGCAGG + Intronic
1157131656 18:45013170-45013192 CAGGAATGGCAGGAGGCTGCAGG - Intronic
1157193506 18:45600703-45600725 CATGAACCAAGGGAGGCAGCAGG + Intronic
1157904731 18:51559462-51559484 GAGGAAACAATGCAGGCTCCAGG + Intergenic
1157906794 18:51576489-51576511 CAGGAAAAAAATGAGTGTGCTGG - Intergenic
1159594802 18:70372321-70372343 CAAGGAAGAGAGGAGGCTGCAGG + Intergenic
1160376104 18:78413890-78413912 AAAGCAACAAAGGAGGCTGATGG - Intergenic
1160751798 19:737877-737899 CAGGAACCATGGGGGGCTGCAGG + Intronic
1160812423 19:1018545-1018567 CAGGAAGCAGAGGAGCCTTCTGG + Intronic
1160911051 19:1473981-1474003 CAAGAAACAAAGCTGGCTGTGGG + Exonic
1161504868 19:4638591-4638613 CAGGACACACAGGAGCCTCCCGG - Intergenic
1162493934 19:11012573-11012595 CAGGAAACCAAGAGGGCTTCAGG - Intronic
1163990415 19:20993947-20993969 CAGGAAACAACAGATGCTGGAGG + Intergenic
1164031919 19:21415267-21415289 CAATTAACAAAGGAGGCTGAGGG - Intronic
1165245753 19:34497616-34497638 CAGGAGAACCAGGAGGCTGCCGG + Intronic
1166393764 19:42424310-42424332 CGGGAAACAGAGGAGGCTCGAGG + Intronic
1166552042 19:43672275-43672297 GAGAAAACAAAGCAGGCTGAAGG + Intergenic
1166876806 19:45902485-45902507 AAGGAGACAACGGAGGCTACGGG + Intronic
1166878728 19:45914125-45914147 CCTGAAACAGTGGAGGCTGCTGG - Exonic
925458927 2:4043270-4043292 CCTGAAACAAAGGTGTCTGCCGG - Intergenic
925762299 2:7197034-7197056 CAAGAAACAAAGGAGGGAACAGG + Intergenic
925843925 2:8018937-8018959 CAGGACATAAAGGGGGCTGAGGG + Intergenic
926294437 2:11558592-11558614 CAGGAAAACAAGGGGGCTGATGG + Intronic
926402500 2:12512402-12512424 CAGGAAACAACAGATGCTGGAGG - Intergenic
926668069 2:15546831-15546853 CAGTAAACTGATGAGGCTGCTGG + Intronic
926833902 2:16996749-16996771 CAGGAAACAACAGATGCTGGTGG - Intergenic
926936848 2:18094543-18094565 CAGGAAACAAAGCATTCTGTTGG - Intronic
926945635 2:18184572-18184594 CAGGAAACAACAGAGGATGCTGG - Intronic
928634928 2:33235391-33235413 CAGGAAACAACAGATGCTGGTGG + Intronic
928946297 2:36774941-36774963 AAGGAAAGAAAGCAGCCTGCTGG + Intronic
929331078 2:40681776-40681798 CAGGAAACAACAGATGCTGGAGG - Intergenic
929355155 2:41014810-41014832 TAGGAACCCAAGGAGGATGCAGG + Intergenic
931759900 2:65407342-65407364 CAGGAAACTGAGGTGGCTGCAGG + Intronic
932617616 2:73244541-73244563 CAGGGAGCAGAGGAAGCTGCTGG + Exonic
932713951 2:74088088-74088110 CAGCAAATACAGGAGACTGCAGG + Intronic
932733849 2:74240308-74240330 AAGGCAGGAAAGGAGGCTGCTGG - Intronic
933326545 2:80844936-80844958 CAGGAAACCAGGGAGGAGGCAGG + Intergenic
933762430 2:85681576-85681598 CAGCAGACAAGTGAGGCTGCAGG + Intergenic
934184951 2:89663389-89663411 CAGGAAGCACATGTGGCTGCGGG + Intergenic
934295220 2:91737512-91737534 CAGGAAGCACATGTGGCTGCGGG + Intergenic
934721301 2:96578808-96578830 CAGGAAACAAAGGTCAATGCAGG + Intergenic
934751977 2:96799490-96799512 GAGGAAACAAAGGATGAGGCAGG - Intronic
935025631 2:99274155-99274177 CAATTAACAAAGGAGGCTGAGGG - Intronic
935378408 2:102423604-102423626 CAGGAAACCAGGGCTGCTGCTGG + Intronic
935523238 2:104135553-104135575 CAGGAAAGAGAGAAGGCAGCAGG + Intergenic
935733672 2:106088595-106088617 CAGGAAACAAAGGAATCTTGTGG - Intergenic
936175051 2:110212396-110212418 CTGGAGGAAAAGGAGGCTGCAGG - Intergenic
936535325 2:113306631-113306653 CAGGAGACAGACAAGGCTGCTGG + Intergenic
936711800 2:115140347-115140369 CAGGCAGCAAGTGAGGCTGCAGG + Intronic
936917618 2:117655811-117655833 CAGGAAAGAAAGGAAACTCCAGG + Intergenic
938067002 2:128286802-128286824 CAGAAAACAGAGCAGGCTGCTGG + Intronic
938540385 2:132280119-132280141 CAGGAGACAGATGGGGCTGCGGG + Intergenic
939940193 2:148340040-148340062 CAGGAAATAAAGGATTCTGAAGG - Intronic
940012408 2:149068855-149068877 CAGGAAGCCTTGGAGGCTGCAGG - Intronic
941148735 2:161887459-161887481 CAGGAAACAACAGATGCTGGAGG - Intronic
941722400 2:168825821-168825843 AAGGAAAAAAAGAAGGCTTCTGG + Intronic
942454714 2:176129981-176130003 GAGGAAACAGTGGAGGCAGCGGG + Exonic
942469567 2:176245570-176245592 TAGGATGCAAAGGAGGATGCTGG + Intergenic
942908064 2:181207317-181207339 CAGAAAAGAAAGGAGGATGTGGG - Intergenic
943346937 2:186749718-186749740 CAGGAAAGAAAGGTGGCCACAGG - Intronic
943406559 2:187494426-187494448 CAGGAAGCAGGGGAGACTGCAGG + Intronic
943616886 2:190102884-190102906 CAGCAAAAAAAGAAGACTGCAGG + Intronic
944094194 2:195947943-195947965 CAGGAAACAACAGATGCTGGAGG - Intronic
945016863 2:205527686-205527708 GAAGAATGAAAGGAGGCTGCAGG - Intronic
945466862 2:210180283-210180305 AAGGGAACAAAAAAGGCTGCTGG - Intergenic
946114665 2:217450878-217450900 TAGGAAGGAAAGGAGGCTGGTGG + Intronic
947701006 2:232233922-232233944 CGGGAACCAAAAGAGCCTGCAGG + Intronic
948304285 2:236935234-236935256 CCAGAAGAAAAGGAGGCTGCAGG + Intergenic
948866441 2:240777456-240777478 CAGGAAACCCAGGGGGCTGCTGG - Intronic
948937199 2:241174583-241174605 CAGGAAACAAATGAGGTGGGTGG - Intronic
948955732 2:241289268-241289290 CATGAGACAAAGGAGGAAGCAGG - Intronic
949006739 2:241653653-241653675 CAGGAAGCAAAGGGGACTGTGGG + Intronic
1168810877 20:703812-703834 CAGGGAACAGAGGATGCTCCTGG - Intergenic
1168846130 20:945870-945892 CAGCAGACAAAGGAAGCTGCAGG - Intergenic
1169130988 20:3166364-3166386 CAGGAAACGCAGGAGGGGGCTGG + Intronic
1171272606 20:23828360-23828382 CAGGTGACAAAGGAGTCTACAGG - Intergenic
1171279058 20:23881330-23881352 CAGGCAACAAAGGAGTCCACAGG - Intergenic
1171284146 20:23923879-23923901 CAGGTGACAAAGGAGTCTACAGG - Intergenic
1171492860 20:25533353-25533375 CAGGAAACAAAACAGACTGCTGG + Intronic
1171543759 20:25985501-25985523 CAGGCAACACCTGAGGCTGCGGG - Intergenic
1173008514 20:39159522-39159544 TAGGAAACCAAGGAGAATGCTGG - Intergenic
1173724862 20:45290390-45290412 CAGGGAACCAAGAAGGCTGAGGG + Intergenic
1174726295 20:52865787-52865809 CAAGATGCAAAGGAGACTGCAGG + Intergenic
1174732263 20:52929454-52929476 GAGTAGACAAAGGAAGCTGCAGG + Intergenic
1177091123 21:16769850-16769872 GAGGAAACAGATGAGGCGGCAGG + Intergenic
1177296395 21:19181779-19181801 CAGGGAACCCAGGAGGGTGCTGG - Intergenic
1177350634 21:19936298-19936320 CTGGAAATAAATGAGGGTGCTGG - Intergenic
1178849721 21:36202839-36202861 CAGGTCACATAGGAGGCAGCTGG + Intronic
1179495648 21:41769712-41769734 CAGGGAACAATGAAGGTTGCCGG + Intergenic
1179887702 21:44321474-44321496 CAGGCAACAGAGGAGGCAGAAGG - Intronic
1180816700 22:18793980-18794002 CAGGAAGCACATGTGGCTGCGGG - Intergenic
1181088824 22:20458220-20458242 GTGGAAACACAGGAGGCTCCTGG - Intronic
1181202891 22:21228327-21228349 CAGGAAGCACATGTGGCTGCGGG - Intergenic
1182001203 22:26921285-26921307 CAGAAAACAAAAGAGGCAGAGGG - Intergenic
1183482858 22:38074649-38074671 CAGGGAACGCAGGAGGCTGCAGG - Intronic
1183971643 22:41482032-41482054 AAGGGAAGAAAGGATGCTGCTGG - Intronic
1184961994 22:47936677-47936699 CAGGATAAAAAGCAGGCAGCCGG - Intergenic
1185064872 22:48627059-48627081 CAGGAAACAGAGGAAGCTGCAGG - Intronic
1185064975 22:48627654-48627676 GAGCCAAGAAAGGAGGCTGCTGG - Intronic
1203224028 22_KI270731v1_random:67099-67121 CAGGAAGCACATGTGGCTGCGGG + Intergenic
1203266799 22_KI270734v1_random:19701-19723 CAGGAAGCACATGTGGCTGCGGG - Intergenic
949472324 3:4409298-4409320 GAGGAAGCAAAGGAGGCCACTGG + Intronic
949631686 3:5935035-5935057 CAGGAAACAACAGATGCTGGAGG - Intergenic
949935370 3:9111736-9111758 CAGAAGACAAAAGTGGCTGCTGG - Intronic
950036438 3:9889287-9889309 AAGAAAACACAGGAGGCTGAGGG - Intergenic
950189236 3:10965253-10965275 CAGAAGACAAAGGAGCCTGTCGG - Intergenic
950712857 3:14825674-14825696 CAGGGAACAAAGAATGCTTCAGG - Intronic
951742191 3:25936954-25936976 CAGGAAACAACAGATGCTGGAGG + Intergenic
952009960 3:28889270-28889292 CAGGAAACAACAGATGCTGGAGG - Intergenic
952431976 3:33232453-33232475 CAAGAAACAAAGAAAGCAGCAGG - Intergenic
953292263 3:41677203-41677225 TAGAAAACAAATGGGGCTGCTGG - Intronic
953366952 3:42353186-42353208 CAGGCAACAAAGATGGCTGATGG + Intergenic
955408170 3:58638997-58639019 CAGGAAACAAAAGGGGATGATGG - Intronic
955762813 3:62306365-62306387 CTGGAAACAACGGATGCTGGAGG + Intergenic
956397595 3:68842196-68842218 CAGGAAACAACAGATGCTGGAGG - Intronic
956794372 3:72704683-72704705 AAGCAAAAAAAGGAGGGTGCAGG + Intergenic
956850374 3:73223333-73223355 CAGGAAACAAAGGAAGAAGTTGG - Intergenic
956932409 3:74059897-74059919 AAGGAAACAAAGAAGGAAGCAGG + Intergenic
957410515 3:79834053-79834075 CAGGAAACAACAGATGCTGGAGG + Intergenic
957622472 3:82611751-82611773 CAGGAAACAACAGATGCTGGTGG - Intergenic
958192732 3:90204219-90204241 GAGGAAACTGAGGAAGCTGCAGG - Intergenic
958416150 3:93876149-93876171 GAGGAAACTGAGGAAGCTGCAGG - Intronic
959136379 3:102427146-102427168 CACGAAATAAAATAGGCTGCTGG - Intronic
961183045 3:124891055-124891077 CTGGACCCAAAGGAGGCTGCTGG + Intronic
961895747 3:130166595-130166617 AAGGAGAAAGAGGAGGCTGCTGG - Intergenic
962164937 3:133038672-133038694 CGGGAAACAAAGGCGGAGGCAGG - Intronic
962659748 3:137589488-137589510 CAGGATACTGAGGAGGGTGCTGG - Intergenic
962909592 3:139835963-139835985 CAGGAAACATTCAAGGCTGCAGG + Intergenic
962914187 3:139883772-139883794 CTGGAAACAATGGATGCTGGAGG - Intergenic
963576791 3:147070357-147070379 CAGGAAACAACAGATGCTGGAGG - Intergenic
964346638 3:155760430-155760452 CAGGAAAGAAAGGTGGCAGAAGG + Intergenic
964406360 3:156352826-156352848 CAGGAAACAGGGCAGGCAGCAGG - Intronic
964642368 3:158923393-158923415 CAGGAAAAAAAACAGGCTGTAGG + Intergenic
965388269 3:168072120-168072142 GAGGAAACAAAAGTGCCTGCAGG + Intronic
966232749 3:177668715-177668737 GAGGACACAAAGGAGGCTTTGGG + Intergenic
967855578 3:194115076-194115098 GGGGACACACAGGAGGCTGCAGG - Intergenic
968724834 4:2241955-2241977 CAGGAAAAAAAAGAGGCACCTGG + Intronic
969315635 4:6380032-6380054 CAGGAAACCAAGGAGGAGGGAGG - Intronic
969325456 4:6441434-6441456 CTGGGAACCAGGGAGGCTGCAGG - Intronic
969475898 4:7422336-7422358 CAGGACCTAGAGGAGGCTGCAGG - Intronic
970398328 4:15694082-15694104 CAGAGAACAAAGGAGACTGGGGG + Intronic
970548575 4:17155603-17155625 CAGGATTCAGAGGATGCTGCTGG + Intergenic
970826685 4:20284874-20284896 TAGGAAACAAATGAGGCAGATGG + Intronic
971265641 4:25094176-25094198 CAGGACTCAGGGGAGGCTGCAGG - Intergenic
971572244 4:28228304-28228326 CAGGAAACAAAAAAGGTTGTTGG - Intergenic
972814832 4:42632674-42632696 AAGAAAACAAAGGATGCTGGTGG + Intronic
974585106 4:63863953-63863975 CAGGAAACAACTGATGCTGGAGG + Intergenic
974839653 4:67286112-67286134 AGGGAAAAAAAGCAGGCTGCGGG - Intergenic
975546726 4:75568032-75568054 CAGGAAACAAAGTAGGAAGCAGG - Intergenic
975712942 4:77178679-77178701 AGGGAAAGAAAGGAAGCTGCAGG + Intronic
976177757 4:82372515-82372537 CGGGAAAAAAAGGGGGCTGGGGG + Intronic
976291989 4:83428645-83428667 CAGGAAAAAAAGCAAGTTGCAGG + Intronic
977978604 4:103296529-103296551 CAGGAAACAACAGATGCTGGAGG + Intergenic
978007131 4:103630672-103630694 CAGGAAACAACAGATGCTGGAGG + Intronic
981037458 4:140187435-140187457 CAGGACACAAGGGATGCTGCAGG + Intergenic
981851281 4:149233282-149233304 CAGGAAACAACAGATGCTGGAGG + Intergenic
982398991 4:154945084-154945106 CTGGACTAAAAGGAGGCTGCAGG + Intergenic
984496001 4:180497815-180497837 CAGGAAACATAGGATAATGCAGG - Intergenic
984961058 4:185099338-185099360 CATGAAATAGAGGAGTCTGCTGG + Intergenic
985023204 4:185713106-185713128 CAGGACACAGAGGATGCTGCCGG - Intronic
985563129 5:601976-601998 CAGGGAGCAAAGGAGGCGGAGGG - Intergenic
985886895 5:2686990-2687012 CAGGAAAAACAGGCGCCTGCAGG + Intergenic
986005489 5:3664303-3664325 CAGGAAACAACAGATGCTGGAGG - Intergenic
986057947 5:4157752-4157774 CAGGAATTACTGGAGGCTGCTGG - Intergenic
986170119 5:5308159-5308181 CTGGAAACCACGGAGGATGCGGG - Intronic
986232924 5:5883636-5883658 CAGGAAACACAGGGACCTGCTGG + Intergenic
987045470 5:14103505-14103527 CAGGGAGCAAAGGAGACTGGGGG - Intergenic
987059678 5:14230463-14230485 AATGAAACAAAGGAGCATGCAGG + Intronic
987398892 5:17454233-17454255 TGGGAAATAAAGGAGGCTGGTGG + Intergenic
987608802 5:20175343-20175365 CAGGAAAAATAGGAGGCAGCAGG - Intronic
987811743 5:22845695-22845717 CATGAAACAAAGGGGGATGCTGG + Intronic
988913131 5:35865609-35865631 CAGGAAACAAAAGGTGCTGGAGG - Intronic
989039168 5:37209091-37209113 CACGAATCAAAGGCGGCTGGAGG - Intronic
991020053 5:61971193-61971215 CTGAAAACAAAGGTGGATGCGGG + Intergenic
994518721 5:100802096-100802118 CAGGAAAGAACGGAGCCTGGTGG - Intergenic
995014780 5:107297804-107297826 CAGAAAACAAATGGGGCTGGAGG - Intergenic
995916099 5:117246649-117246671 CTGCAAACACAGGAGGCTCCAGG - Intergenic
997422306 5:133779217-133779239 CAGGAGTGGAAGGAGGCTGCGGG - Intergenic
997427490 5:133813781-133813803 CAGGAAATATAGGAGCCTGATGG - Intergenic
997454125 5:134004918-134004940 CAGCAGACACAGGAGCCTGCGGG + Exonic
997642000 5:135455463-135455485 CTGGAAACAAATGTGGCTCCTGG + Intergenic
997891980 5:137684993-137685015 CAGGAAACCAAATAGGCAGCTGG + Intronic
998409444 5:141898132-141898154 CAGGAAAGAAAGGAGGGAGAAGG - Intergenic
999242844 5:150137548-150137570 CAGGAAATGGAGGAGGCTGTGGG + Intronic
999371818 5:151060265-151060287 CAGGACACAAAGAGGGCAGCAGG + Intronic
999877992 5:155829577-155829599 CAGGCCTCGAAGGAGGCTGCTGG + Intergenic
999901583 5:156091765-156091787 CTGGAACAAAAGGAGGCTACTGG - Intronic
1000030962 5:157401227-157401249 AAGGAAGCAAAGCAGCCTGCTGG + Intronic
1000495750 5:161982184-161982206 CAGGAAACAACAGATGCTGGAGG - Intergenic
1001126533 5:169024552-169024574 CTGGAAACCAAGGAAGCAGCAGG - Intronic
1002299687 5:178250239-178250261 GAGGAAACAGAGGAGGCGGTGGG - Intronic
1002356166 5:178630791-178630813 CAGGAAACACTGGAGGCAGCTGG - Intergenic
1003438278 6:6114855-6114877 CAGGAAACAACAGATGCTGGAGG - Intergenic
1004663424 6:17729529-17729551 AAGGAATAAAAGCAGGCTGCCGG + Intergenic
1004925954 6:20415316-20415338 GAGGGGACAAAGGAGGCTTCAGG + Intronic
1005648827 6:27867441-27867463 AAGGCAACTAAGAAGGCTGCCGG - Exonic
1005880781 6:30058484-30058506 CAGAACACAAAGGAGGCTTGAGG - Intergenic
1005925357 6:30440198-30440220 CAGGAAAAAAAGGAGGACCCAGG + Intergenic
1007578028 6:42938680-42938702 CAGCAAACAAAGGAAGGAGCTGG + Exonic
1010011629 6:71054214-71054236 ATGAAAACAAAGGTGGCTGCTGG + Intergenic
1010445251 6:75942227-75942249 CAAGAAAAAAAGGCAGCTGCTGG - Intronic
1011302345 6:85889566-85889588 CAGGAAACAACAGATGCTGGAGG - Intergenic
1011776299 6:90734393-90734415 CAGGAAACAACAGATGCTGGAGG - Intergenic
1012007322 6:93729817-93729839 CAGGAAACAAAGTCAGCTGGTGG + Intergenic
1012208805 6:96495019-96495041 CAGGAAACAACAGATGCTGGAGG - Intergenic
1012630007 6:101454111-101454133 CAGGAAAGAGAGGAGGCAACAGG - Intronic
1013390865 6:109685070-109685092 CAGGAAACAACAGATGCTGGAGG + Intronic
1014153593 6:118086622-118086644 CAAAGAACAAAGGAGGCTGGAGG - Intronic
1014762916 6:125377685-125377707 CAACAAACAACGGAGGCTGCTGG + Intergenic
1015078256 6:129190379-129190401 AAAGCAACAAAGAAGGCTGCTGG - Intronic
1015418728 6:132981746-132981768 CAGGAAACAACAGATGCTGGAGG - Intergenic
1016037757 6:139400917-139400939 CTGGCATCAAAGGAGGCTGAAGG - Intergenic
1016515172 6:144885052-144885074 CTGTAAATAAAGAAGGCTGCAGG + Intergenic
1016562723 6:145414972-145414994 CAGGAGACAAAGTAGGATACGGG - Intergenic
1016585396 6:145678741-145678763 CAGGAAACAACAGATGCTGGAGG + Intronic
1016700717 6:147050901-147050923 CAGAGGACAAAGGATGCTGCTGG + Intergenic
1016855688 6:148668426-148668448 CAGGAAACAACAGATGCTGGAGG - Intergenic
1018013644 6:159693436-159693458 CACGGGAGAAAGGAGGCTGCAGG + Intronic
1018557612 6:165064986-165065008 CAGGAAAGAAAGGGGGCCCCAGG + Intergenic
1018863169 6:167726939-167726961 CAGGAGGCAGAGGAGGCTGTGGG + Intergenic
1019300416 7:300298-300320 CTAGAAACAAAGGAGGCTGTGGG - Intergenic
1019410115 7:903046-903068 CAGGAACCAGATGAGGCTGCAGG + Intronic
1019447534 7:1079134-1079156 CAGGGCACAAAGGTGGCTACGGG + Intronic
1021145584 7:17084824-17084846 CAGGTATCAATGGAGGCTGAGGG - Intergenic
1021162238 7:17289141-17289163 CAGAAAACAATGGAAGCAGCAGG + Intergenic
1021557287 7:21933142-21933164 CAGGAAACAACAGATGCTGGAGG + Intronic
1022556726 7:31305667-31305689 CAGGGAAGAAAGGGGGCTTCAGG + Intergenic
1023029782 7:36081884-36081906 CAGGAAACAAAGCAGGCATCAGG - Intronic
1023063740 7:36354200-36354222 CAGGACATACAGCAGGCTGCAGG - Intronic
1023221898 7:37928103-37928125 CAGGAGAGTAAGGAGGCTGATGG + Intronic
1023289088 7:38650701-38650723 CAGGAAACAACAGATGCTGGGGG + Intergenic
1023315736 7:38934518-38934540 GGGGAAACAAAGGACACTGCAGG - Intergenic
1023473661 7:40552772-40552794 CAGGAAACAAAGCTGGGTGGTGG - Intronic
1023863124 7:44227164-44227186 CAGGGGACAGAGGAGGGTGCAGG + Intronic
1023863130 7:44227183-44227205 CAGGGGACAGAGGAGGGTGCAGG + Intronic
1023864172 7:44231057-44231079 GAGGAAACACGGGAGGCAGCGGG + Intronic
1024904103 7:54356495-54356517 CAGTAACCAGAGGAAGCTGCTGG + Intergenic
1026566171 7:71491332-71491354 TAGGAAAAAATGAAGGCTGCTGG - Intronic
1026586112 7:71657544-71657566 CAGGCAACAAATGAGGATGCAGG - Intronic
1026616622 7:71910748-71910770 CAGGAAACAAGGGTAGCTTCAGG - Intronic
1027266004 7:76495627-76495649 CAGCAAACACAGAGGGCTGCAGG + Intronic
1027317378 7:76993744-76993766 CAGCAAACACAGAGGGCTGCAGG + Intergenic
1027451967 7:78342296-78342318 CAGGAAACAACAGATGCTGGAGG + Intronic
1028950766 7:96632045-96632067 CAGGAAACAACAGATGCTGGAGG + Intronic
1030160009 7:106497827-106497849 CAGGAAACAACAGATGCTGGAGG + Intergenic
1030220298 7:107091564-107091586 CAGGAACCAAGTGAGCCTGCAGG - Intronic
1030277993 7:107740379-107740401 CAGAAAAGAAGGAAGGCTGCAGG + Intergenic
1030872548 7:114774970-114774992 AAGGAAACAGAGAAGGCTCCAGG - Intergenic
1031900285 7:127401748-127401770 CAGGAAACAACAGATGCTGGAGG - Intronic
1032456424 7:132076457-132076479 CAAGGAACACAGGAGGCAGCTGG - Intergenic
1032659246 7:133964979-133965001 CAGGAAACAACAGATGCTGGAGG - Intronic
1033417373 7:141174611-141174633 CAGGAAACAACAGATGCTGGAGG - Intronic
1033630311 7:143151190-143151212 CAGGAAACAACAGATGCTGGAGG - Intergenic
1033712127 7:143958604-143958626 TAGGAAACAAATGAGGCAGGAGG - Intergenic
1034031358 7:147768685-147768707 CAGAAAACAACTGAGGCTTCAGG + Intronic
1034186281 7:149179635-149179657 CAGGCCACAATGGAGGCTGTGGG + Exonic
1034541334 7:151760193-151760215 AAGGAAGCAAAGCAGGCTGATGG - Intronic
1035619860 8:1028680-1028702 GTGGAGACAAAGGAGGCTGGTGG + Intergenic
1035752163 8:2003308-2003330 CAGGACACAGAGAAGGCTGTGGG + Exonic
1036391488 8:8328064-8328086 CGGGCAACAGAGGCGGCTGCGGG - Exonic
1037393602 8:18419727-18419749 CAGAATACAAAGGAAGCTGGTGG + Intergenic
1038617167 8:29105446-29105468 CAGGACTCACAGGAGGCTGCAGG - Intronic
1038629513 8:29227990-29228012 CAGGAAAGAAAGGTAGCTGAAGG - Intronic
1039762241 8:40590132-40590154 CAGAATACTAAGGAGGCTGAGGG - Intronic
1040300064 8:46183348-46183370 CAGGACAGACAGGAGGCTTCTGG + Intergenic
1040857552 8:51963966-51963988 CTGGAGAAAAAGGAGGCTGAGGG - Intergenic
1041129960 8:54687961-54687983 CAGGAAACAACAGATGCTGGAGG - Intergenic
1041359857 8:57041676-57041698 CAGGGAACAAAGGAGACTAGGGG + Intergenic
1042467395 8:69143337-69143359 AAAGAAACAAAGGAGGGTGAGGG - Intergenic
1042638126 8:70901308-70901330 CAGGAAACAACAGATGCTGGAGG - Intergenic
1044061193 8:87638038-87638060 CAGGATATGAAGGAGGCTACTGG - Intergenic
1044258519 8:90093081-90093103 GAGGAAGCAAAGGAGGCTTTTGG + Intronic
1045006217 8:97919011-97919033 CAGGAGACAAAAGAGACTCCAGG + Intronic
1046484573 8:114869822-114869844 CAGGAAATACAGGTGGCTTCAGG + Intergenic
1046690935 8:117283347-117283369 TAGGAAACAAAGGTATCTGCAGG + Intergenic
1046815488 8:118578731-118578753 GAGGAAACAACAGTGGCTGCTGG - Intronic
1047102744 8:121696052-121696074 CAAGAAACTGAGGAGGCAGCAGG + Intergenic
1047279816 8:123435450-123435472 CTAGTAACAAAGGAGGCTTCTGG - Intronic
1048144363 8:131825729-131825751 CAGGCAGCAAAGGAGACTGCAGG + Intergenic
1048527809 8:135219952-135219974 CAGGATACACAGAAGGATGCAGG + Intergenic
1049308501 8:141920629-141920651 CAGGAATCACAGGAGTCTGGTGG - Intergenic
1049326299 8:142023245-142023267 CAGACAAAGAAGGAGGCTGCTGG - Intergenic
1049436459 8:142588361-142588383 CAGGAGACAACGAAGGCAGCCGG - Intergenic
1049576189 8:143391001-143391023 TGGGCAACATAGGAGGCTGCTGG + Intergenic
1050865505 9:10492362-10492384 CAGGAAACAACAGATGCTGGAGG - Intronic
1050963868 9:11771691-11771713 CAGGAAACAACAGATGCTGGCGG + Intergenic
1051097555 9:13483964-13483986 CAGGAGAAAAAGGAGGCTGTGGG - Intergenic
1051255907 9:15213209-15213231 CAGGAGACAAAGAAGTCTGAGGG + Intronic
1052317197 9:27127628-27127650 CAGGAAACAACAGATGCTGGAGG - Intronic
1055193883 9:73562996-73563018 CAGCTAACAAGGGAGGCTGAAGG + Intergenic
1055372665 9:75617067-75617089 CAGGGAGCAAACAAGGCTGCTGG - Intergenic
1056733175 9:89183132-89183154 CAGAAAGCAGGGGAGGCTGCAGG + Intergenic
1057461402 9:95265927-95265949 AAGGAAACACAGGGGGCTGCAGG + Intronic
1057758948 9:97857641-97857663 CAGGAGAGAGAGGACGCTGCGGG + Intergenic
1058557003 9:106179932-106179954 GAGGAAAAAAAGGAGGATGAGGG - Intergenic
1059058823 9:111014025-111014047 CAGGAAAGAATGGAGGGAGCAGG - Intronic
1059261469 9:112981207-112981229 CAGGAAACAACAGATGCTGGAGG + Intergenic
1059574716 9:115476189-115476211 GAGGACACAAAGGAGGCTTTGGG - Intergenic
1060157223 9:121328144-121328166 CTGGAAACAGAGCAGGCTGGTGG - Intronic
1060202971 9:121662826-121662848 CAGGAAACTAAGGAGGTCTCAGG - Intronic
1060747076 9:126144636-126144658 CACAAAAAAAAGAAGGCTGCAGG + Intergenic
1060763650 9:126276652-126276674 CAGGAAGGAGAGGAGGCTGCTGG + Intergenic
1060782818 9:126425688-126425710 CAGGACATAAAGGATGGTGCTGG - Intronic
1061361033 9:130142448-130142470 CAGCAAACAGAGGAGGCAGAGGG - Intergenic
1061551710 9:131338704-131338726 CAAGGAACACTGGAGGCTGCTGG + Intergenic
1061851924 9:133421363-133421385 CAGGAAGGTAAGGAGGCTGTTGG - Intronic
1062515411 9:136931901-136931923 CAAGAAACAAAGTAAGCTGTGGG - Intronic
1203412936 Un_KI270589v1:12442-12464 CAGGAAACAACAGGTGCTGCAGG + Intergenic
1203685257 Un_KI270757v1:47429-47451 CAGGAAACAACAGGTGCTGCAGG - Intergenic
1185840580 X:3386465-3386487 CAGAAAAAAAGGGGGGCTGCAGG + Intergenic
1186465102 X:9779003-9779025 CAGAAAACAGTGGAGGCTGGGGG - Intronic
1187763622 X:22614660-22614682 CAGGAAACAAAAGGTGCTGGAGG + Intergenic
1189185555 X:39051911-39051933 AAGGAAGCAAAGGAGGGGGCAGG + Intergenic
1190823193 X:53993590-53993612 CAGAAAGCAAAGGTGGGTGCTGG - Exonic
1190870279 X:54419164-54419186 CAGGAAATAAAGGGAGCTGCAGG - Intergenic
1191970100 X:66804381-66804403 CAGGAAACAACAGATGCTGAAGG + Intergenic
1192423254 X:71052869-71052891 CAGGCAACAGAGGCGGCAGCTGG + Intergenic
1193405584 X:81097195-81097217 CAAGTAAAAAAGGAGGCTGTTGG - Intergenic
1193844738 X:86455068-86455090 CAGGAAAAAAATGAGGCAACTGG - Intronic
1194930160 X:99878414-99878436 CAGGAAACAACAGATGCTGGAGG + Intergenic
1195282585 X:103350350-103350372 CAGGAAACTCAGGAGGAGGCTGG + Intergenic
1195451071 X:105013591-105013613 GAGGAAACTAAAGAGGCTTCTGG + Intronic
1195738906 X:108042554-108042576 AAGGAAACACAGGAAGCTTCTGG + Intergenic
1197135075 X:123051323-123051345 CAGGAAACAACAGATGCTGGAGG - Intergenic
1197135212 X:123052517-123052539 CAGGAAACAACAGATGCTGGAGG + Intergenic
1197568539 X:128119405-128119427 AAGGAAACAAAGGAGGTTGTAGG - Intergenic
1198015958 X:132611202-132611224 AAGGCAACAAAGGAGGCTGAAGG + Intergenic
1198440699 X:136660309-136660331 CTGGAAACAATGGAGACTGCAGG - Exonic
1198514431 X:137390663-137390685 CAGGAAACAACAGATGCTGGAGG + Intergenic
1199432507 X:147776979-147777001 CAGAAAACAAAGGAAGCTCCTGG + Intergenic
1200089819 X:153629329-153629351 CAGGATAAAAATGAGGCTGAAGG - Intergenic
1200310122 X:155070092-155070114 TAGGTAAAAACGGAGGCTGCTGG + Intronic
1201273561 Y:12278565-12278587 CAGGAAACAGAGGAGACAGAAGG - Intergenic
1201937232 Y:19421813-19421835 GAGGACACAAAGGAGGCTTTGGG - Intergenic
1202024783 Y:20510063-20510085 AAGGAAAAGAAGGAGACTGCAGG + Intergenic
1202130357 Y:21603589-21603611 CAGGGAGCAAAGGAGACTTCAGG - Intergenic