ID: 1129193501

View in Genome Browser
Species Human (GRCh38)
Location 15:73951308-73951330
Sequence GCTCTTGGAAGGAAGGGCTT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 359
Summary {0: 1, 1: 0, 2: 3, 3: 32, 4: 323}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1129193501_1129193507 1 Left 1129193501 15:73951308-73951330 CCAAAGCCCTTCCTTCCAAGAGC 0: 1
1: 0
2: 3
3: 32
4: 323
Right 1129193507 15:73951332-73951354 CTTTACATAAGTGCTTGGAAAGG 0: 1
1: 0
2: 0
3: 11
4: 159
1129193501_1129193506 -4 Left 1129193501 15:73951308-73951330 CCAAAGCCCTTCCTTCCAAGAGC 0: 1
1: 0
2: 3
3: 32
4: 323
Right 1129193506 15:73951327-73951349 GAGCTCTTTACATAAGTGCTTGG 0: 1
1: 0
2: 0
3: 7
4: 100
1129193501_1129193509 6 Left 1129193501 15:73951308-73951330 CCAAAGCCCTTCCTTCCAAGAGC 0: 1
1: 0
2: 3
3: 32
4: 323
Right 1129193509 15:73951337-73951359 CATAAGTGCTTGGAAAGGCCGGG 0: 1
1: 0
2: 0
3: 8
4: 147
1129193501_1129193508 5 Left 1129193501 15:73951308-73951330 CCAAAGCCCTTCCTTCCAAGAGC 0: 1
1: 0
2: 3
3: 32
4: 323
Right 1129193508 15:73951336-73951358 ACATAAGTGCTTGGAAAGGCCGG 0: 1
1: 0
2: 1
3: 19
4: 153

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1129193501 Original CRISPR GCTCTTGGAAGGAAGGGCTT TGG (reversed) Intronic
900146547 1:1161218-1161240 GCTCTGGGGTGGAAGGGCTGGGG - Intergenic
900547788 1:3238085-3238107 GGGTTTGGAAGGTAGGGCTTAGG + Intronic
900617929 1:3573662-3573684 GCTCCTGGAAGGGCGGGCTCTGG - Intronic
900754567 1:4424780-4424802 GCTCTTGGAACAAAGGACCTGGG - Intergenic
901090129 1:6635403-6635425 GTTCCTGGAGGGAAGGGCTCTGG - Exonic
901261420 1:7874593-7874615 GCTCTGGGAAACATGGGCTTTGG - Intergenic
901763212 1:11484049-11484071 GCACTTGGAAGGAAGTTGTTAGG - Intronic
902782929 1:18716239-18716261 GCCTTTGGAAGGATGGGCCTGGG + Intronic
902827342 1:18985684-18985706 GCTCTTGGAGGCAAAGTCTTTGG + Intergenic
902874045 1:19330465-19330487 TCTCCTGGAAGGCAGGGCCTTGG - Intergenic
903161263 1:21490835-21490857 GCTCTTGGAGGAAAGGGGATGGG - Intergenic
903387110 1:22934427-22934449 GCTCTTGGAAGGATGGGGCAGGG + Intergenic
905296255 1:36956218-36956240 GCCCTTGGAAGACAGGGCTGAGG + Intronic
905401915 1:37709915-37709937 GCTCATGGAATGAAGGTGTTGGG - Intergenic
905806920 1:40884164-40884186 GCTCCTGGCAGTAGGGGCTTCGG + Intergenic
905976240 1:42175948-42175970 GCTCTGGGAAGGCAGTGCTGGGG + Intergenic
906203179 1:43972750-43972772 GCTGATGGAATAAAGGGCTTAGG + Exonic
906244564 1:44263819-44263841 TATCTTGGGAGGAAGGGCTCAGG - Intronic
907317263 1:53580282-53580304 GCTCGGGAAAGGGAGGGCTTGGG - Intronic
910717579 1:90248946-90248968 GCTCTTGTAAGGCAGGCCTGTGG - Intergenic
910863313 1:91764537-91764559 GCTCTGGGAAGGAAGGGCCTGGG - Intronic
911079509 1:93914767-93914789 GCTCTTGTAAGGTAGGCCTGGGG + Intergenic
911143282 1:94528665-94528687 GCTCTTGGAGGGCAGGGACTGGG - Intergenic
912488384 1:110047133-110047155 GCTCTTTGAGGGCAGGGCCTGGG - Intronic
913120334 1:115734377-115734399 CCTGTTGGAAAGAATGGCTTAGG + Intronic
914946190 1:152068717-152068739 GCTCATGGAATAATGGGCTTGGG + Intergenic
917724492 1:177815880-177815902 AGACTTTGAAGGAAGGGCTTTGG + Intergenic
919134077 1:193487114-193487136 GATATTGGAAGGAAGGGGTATGG + Intergenic
920827266 1:209433727-209433749 GGTCTTGGAATGAAGGGGTGGGG - Intergenic
920966773 1:210707550-210707572 GCTCTTGGCAGGCAGAGCTTAGG + Intronic
922711016 1:227832569-227832591 GATCTTGGAGGGAAGGCTTTCGG - Intronic
923879433 1:238087207-238087229 GCCCTTGAAGGGAATGGCTTCGG + Intergenic
1064273744 10:13888061-13888083 GCTCTTGGAACTTTGGGCTTTGG - Intronic
1066159881 10:32716364-32716386 GCTCTTGTAAGGCAGGCCTGTGG - Intronic
1066588137 10:36960801-36960823 GCTCCTGGAAGGTGGGGGTTTGG + Intergenic
1067218732 10:44325953-44325975 TCTCTTGCAGGGAAGGGTTTAGG + Intergenic
1067279349 10:44859587-44859609 GCGCTGGGATGGAAGGGCCTGGG - Intergenic
1068385940 10:56327512-56327534 GCTCTGGGGAGGAAGGGGTATGG - Intergenic
1068990804 10:63148425-63148447 GGTCTTGGAAGGTATGGGTTAGG + Intronic
1069269914 10:66513783-66513805 GCTCTTGGAAGCATGTGCTTTGG + Intronic
1069814570 10:71185640-71185662 GATGGTGGAAGGAAAGGCTTAGG - Intergenic
1071171347 10:82868466-82868488 TTTCTTGGAGGGAAGGGGTTGGG + Intronic
1071966301 10:90856812-90856834 GTTTTTGGAAGGAAGGGATTTGG - Intronic
1073935287 10:108623876-108623898 GTTCTAGTAAGCAAGGGCTTTGG - Intergenic
1074514748 10:114156006-114156028 GCTCATGAAAGGAAGGGCTCTGG + Intronic
1074813562 10:117127662-117127684 ACTCTTAGAAGGAATGGCTGAGG - Intergenic
1075347744 10:121696689-121696711 GATCTTGGATGGATGAGCTTTGG - Intergenic
1075701221 10:124470418-124470440 GCTACTGGACGGAAGGGCTGTGG - Intronic
1075790165 10:125078305-125078327 TCTCATGGGAGGATGGGCTTGGG + Intronic
1076637565 10:131892196-131892218 GCTATTGGGAGGAAGGGCTAAGG + Intergenic
1077358865 11:2130917-2130939 GCTCCTGGAAGGAAGATCTTGGG - Intronic
1077481962 11:2819186-2819208 GCCCTTGGGAGGAGGGACTTTGG - Intronic
1077498765 11:2899463-2899485 ACTGGAGGAAGGAAGGGCTTTGG - Exonic
1077923317 11:6656693-6656715 GATATTGGAAAGAAGAGCTTTGG + Intergenic
1079265078 11:18923072-18923094 GCTCTTGTAAGGCAGGCCTGGGG - Intergenic
1081287973 11:41295797-41295819 GTTCTGTGAGGGAAGGGCTTGGG + Intronic
1081425081 11:42917523-42917545 GCTCTTGTAAGGCAGGCCTGGGG - Intergenic
1081854331 11:46294602-46294624 GCTCTGGGAAGGCAAGGCCTGGG + Intronic
1082988246 11:59186085-59186107 GCTCTGGGAAGGAGGGGTCTGGG - Intronic
1084334619 11:68449387-68449409 GCTCCTGCAGGGAAGGGCTGGGG + Intergenic
1085108821 11:73869413-73869435 GACCTTGAAAGGAAGGGCTAAGG + Intergenic
1085644405 11:78213831-78213853 GCTCCTGGAGGGAAGGGGTCAGG - Exonic
1085849248 11:80100338-80100360 GCTCTAGGAAGTTAGTGCTTAGG - Intergenic
1089073849 11:115721459-115721481 ACTCTTGGAAGGAAAGGCCAAGG - Intergenic
1089613406 11:119681958-119681980 GCTCTTGGAGCAAGGGGCTTAGG + Intronic
1089974046 11:122717239-122717261 GGATTTGGAAGGAAGGCCTTAGG - Intronic
1090011599 11:123050325-123050347 GGTCTTGCCAAGAAGGGCTTCGG - Intergenic
1091326164 11:134689822-134689844 GCTCCTGGGAGGAAGGCTTTTGG - Intergenic
1091363993 11:135001748-135001770 GCTCTTGGAGGGAGGGCCCTTGG + Intergenic
1091504519 12:1053511-1053533 ATTCTTCGAAGCAAGGGCTTTGG + Intronic
1094018068 12:25884941-25884963 GCTCCTGGATGGAAGGGCATGGG + Intergenic
1094434958 12:30411002-30411024 GCCCATGGAAGGTAGGGTTTTGG - Intergenic
1096192059 12:49625899-49625921 GCTCAGCGAAGGAAGGGCTTTGG + Intronic
1097913580 12:64996254-64996276 GTTCTTGGAAGGAATGGCCTGGG + Intergenic
1098234905 12:68408993-68409015 GCTCTTGGAAGGGAAGGACTGGG - Intergenic
1098668972 12:73200329-73200351 GTTCTTGCAAGGAGGGTCTTGGG + Intergenic
1101556663 12:105816572-105816594 GCTCTTGTGAGGAAGGGATGAGG + Intergenic
1101569085 12:105936774-105936796 GCCATTGTCAGGAAGGGCTTTGG + Intergenic
1101603178 12:106227844-106227866 ACTCTTGGCAGGAAGGGGTGTGG - Intergenic
1101858969 12:108467283-108467305 GCTCATGGGGAGAAGGGCTTTGG - Intergenic
1102548951 12:113677016-113677038 GCTTTAGGAAGGCAGGGCTGAGG + Intergenic
1103743593 12:123107475-123107497 CCTTCTGGAAGGAAGGGCTCTGG + Intronic
1104467641 12:129003809-129003831 GCCCCAGGCAGGAAGGGCTTGGG + Intergenic
1104649379 12:130520774-130520796 CATCATGGTAGGAAGGGCTTTGG - Intronic
1105591379 13:21795722-21795744 GGTCTTGGGAGGAAAGGCATTGG + Intergenic
1106230052 13:27814703-27814725 GCTCTAGGAGGGCAGGGCTTTGG - Intergenic
1106454187 13:29912153-29912175 TCCCCTGGAAGGAAGGGCTGGGG + Intergenic
1106585940 13:31056126-31056148 CGTCTTGGAGGAAAGGGCTTTGG - Intergenic
1107804913 13:44144524-44144546 GTTGTTGGATGGAGGGGCTTGGG - Intronic
1110161534 13:72384295-72384317 GACCTTGGAAGGAAAGGATTTGG - Intergenic
1110644238 13:77863266-77863288 GCTCTCGGAGGACAGGGCTTGGG - Intergenic
1111590227 13:90336957-90336979 GCTCTGGGGAGGAAGGGTTGAGG - Intergenic
1111728591 13:92043671-92043693 GCTCTTGGAAGGAGTGACTAAGG + Intronic
1112283947 13:98087558-98087580 GCACTGGGCAGGAAGGGCCTCGG - Intergenic
1113019587 13:105869399-105869421 CCTCTTGGAAGGTAGAGGTTAGG + Intergenic
1113399178 13:109975720-109975742 GCCATTGGAGGGAAAGGCTTGGG - Intergenic
1113531642 13:111031906-111031928 GCTCCTGGAAGGTCTGGCTTGGG + Intergenic
1116708975 14:48340418-48340440 GCTCTTGTAAGGCAGGTCTGTGG + Intergenic
1117172977 14:53119129-53119151 GCTCTTGTAAGGCAGGCCTAGGG - Intronic
1118467150 14:66041334-66041356 GGCCTTGGAAGGAAGGGGGTGGG + Intergenic
1119696312 14:76716007-76716029 GCTCCTGGAAGGGAGGATTTAGG - Intergenic
1121627964 14:95400515-95400537 GCTCCAGGAAGGCAGGGTTTGGG + Intergenic
1121729751 14:96178229-96178251 GCTCTCGGAAGGAACGCCCTGGG - Intergenic
1122055464 14:99095149-99095171 GATCTTGGAAGGAAGGCCCAGGG - Intergenic
1122251364 14:100442119-100442141 TCTTTTGGAGGGATGGGCTTGGG + Intronic
1122481139 14:102048271-102048293 TCTCTAGGGAGGAAGGGCTGCGG - Intronic
1122617706 14:103031672-103031694 GCTCTCAGCAGGAAGGGCCTGGG + Intronic
1122863573 14:104593499-104593521 CCTCTTGGAAGGAGGTGCGTGGG + Exonic
1202923414 14_KI270724v1_random:4235-4257 GCTCCTGGAAGGAAGGGCGGAGG - Intergenic
1125722172 15:41850551-41850573 GATTCTGGCAGGAAGGGCTTGGG + Intronic
1126074327 15:44894701-44894723 GCTCTTGTAAGGCAGGCCTGGGG + Intergenic
1126095997 15:45091133-45091155 GAGATTGGATGGAAGGGCTTTGG - Intergenic
1126156898 15:45574248-45574270 GCTCCTGGGAGGAAGGGGGTGGG - Intergenic
1126477430 15:49080096-49080118 GCTGTTGGAAGGGAAGGTTTGGG - Intergenic
1128097645 15:64970329-64970351 GCTCTTTGGAGGAGGGGATTAGG - Intronic
1128850717 15:70953305-70953327 GCTCTTGTAAGGCAGGTCTAGGG + Intronic
1129193501 15:73951308-73951330 GCTCTTGGAAGGAAGGGCTTTGG - Intronic
1130025386 15:80266679-80266701 TCTCTGGGAAGGTTGGGCTTGGG + Intergenic
1133220298 16:4316672-4316694 GCTGCTGCTAGGAAGGGCTTTGG + Intronic
1133330709 16:4971632-4971654 GCTCTCTGAAGGTAGAGCTTTGG + Intronic
1134635264 16:15786929-15786951 CCTCTTGGAAGGAATAGATTGGG - Intronic
1134671849 16:16061560-16061582 GGTGTTAGGAGGAAGGGCTTGGG - Intronic
1135597545 16:23755410-23755432 GCGGTTGGAAGGGATGGCTTTGG + Intronic
1136296457 16:29306572-29306594 GTTCATGGAAGTTAGGGCTTCGG + Intergenic
1136318879 16:29469750-29469772 GCTCCCGGAAGGAAGGGGTGGGG - Intergenic
1136433451 16:30209094-30209116 GCTCCCGGAAGGAAGGGGTGGGG - Intergenic
1136984201 16:35084235-35084257 GCTCTGCTAGGGAAGGGCTTCGG - Intergenic
1138298851 16:55909883-55909905 CATCTTGGAAGGCAGGGCTGGGG - Intronic
1138595518 16:58027167-58027189 GCTGTTGGGAGGAAGCGCTGTGG - Intronic
1138629800 16:58284476-58284498 GCTCTGTGAGGGCAGGGCTTGGG - Intronic
1140268477 16:73441517-73441539 GCTCTTGGGAGGCAGGTTTTGGG - Intergenic
1141598578 16:85112153-85112175 GCTCAGGGAAGACAGGGCTTGGG - Intronic
1142006374 16:87691287-87691309 GCTGCAGGAATGAAGGGCTTTGG + Intronic
1142006378 16:87691303-87691325 GCTTTGGGAATGAAGGGCTGTGG + Intronic
1142360066 16:89621661-89621683 GCACATGCAAGGAAGGGCTCAGG + Intronic
1142564047 17:827953-827975 TATCTTGGCAGGAAGGGCTGTGG + Intronic
1142977552 17:3654871-3654893 GCTCTTGGAAGGTGAGGCTGCGG + Intronic
1143027235 17:3948046-3948068 GCTCTAGGAAGGCAGGGTTTGGG + Intronic
1143163516 17:4886219-4886241 GCTCTGGGAAGGAAGGTCCCTGG + Intronic
1143749678 17:9019724-9019746 GCTCTTAGGAGGAAACGCTTCGG - Intergenic
1143844984 17:9767213-9767235 GCACTGGGAAGGAAGGGGTCAGG - Intergenic
1144006623 17:11106174-11106196 GCTCCTGGAAGGTAGGGGTGTGG - Intergenic
1144420759 17:15095903-15095925 TCCTTTGGAAGGAAGGGCTCTGG + Intergenic
1144444718 17:15316298-15316320 CCTCTTGGGAGGTGGGGCTTGGG + Intronic
1144445310 17:15321904-15321926 CCTCTTGGGAGGTGGGGCTTGGG + Intronic
1144664255 17:17091277-17091299 GGTCTGGGAAGGAGGGTCTTTGG + Intronic
1145043180 17:19592070-19592092 GCTGTTGGAAGGAAGGTCAGTGG + Intergenic
1145820396 17:27829440-27829462 GCTTTGGGAAGCAAGGGCTGGGG - Intronic
1145821545 17:27840383-27840405 GCTTTGGGAAGCAAGGGCTGGGG + Intronic
1145924057 17:28632901-28632923 GCAGTGGGGAGGAAGGGCTTGGG - Intronic
1147887415 17:43693500-43693522 GCTCATGGAAGCAGGGCCTTGGG + Intergenic
1148119869 17:45202186-45202208 GCTGTTGGGAGGGAGAGCTTTGG + Intergenic
1148582383 17:48752803-48752825 GCCTTTGGGAGGAAGGGCCTAGG + Intergenic
1148744977 17:49913015-49913037 GGTCTTGGAGGTCAGGGCTTTGG + Intergenic
1149970437 17:61212913-61212935 GCTTTTGAAAGGAAGGACTTGGG - Intronic
1151714087 17:75822709-75822731 ACTCTGTGAAGGAAGGTCTTGGG - Intronic
1155042800 18:22078988-22079010 GTTCTTAGAAAGAAGGGCTTGGG - Intergenic
1156415485 18:36884298-36884320 CCTCTTTGAAAGAAGGGCCTGGG + Intronic
1156676743 18:39536123-39536145 GCACCTGGAAAGAAGGGCATCGG + Intergenic
1157760961 18:50265507-50265529 GCTCCTTGAAGGGAGGGCTCAGG + Intronic
1158139492 18:54241823-54241845 GCTCCTGGATGGAAGGGGGTGGG - Intergenic
1159957564 18:74530453-74530475 TCTCCTTGAAGGCAGGGCTTGGG + Intergenic
1161406092 19:4092017-4092039 CCTCTTGGTTGGAAGGGCTGGGG + Intronic
1161421717 19:4179657-4179679 GCTTCTGGAGGGCAGGGCTTGGG - Intronic
1162586014 19:11559025-11559047 GCGCTTGGAAGGATGGGGTCGGG + Intronic
1162588603 19:11576684-11576706 GATCTCGGAAGGCAGGGCTGAGG + Intronic
1163102701 19:15107675-15107697 GGTCCTGGAAGGAAGGGGCTGGG + Intronic
1163364089 19:16866501-16866523 GCTCTTGGAGCGCAGGGCCTTGG - Exonic
1164325198 19:24185100-24185122 GCTCCTTGTAGGTAGGGCTTAGG + Intergenic
1164616021 19:29667196-29667218 GGTCGAGGAAGGAAGGCCTTGGG - Intronic
1166193373 19:41190696-41190718 GCTCTTGAGAGAAAGGGCTCTGG + Intergenic
1166378907 19:42344370-42344392 GATCTGGGAAGGAAGGGCTGTGG - Intronic
1166542028 19:43611816-43611838 GCTCCTTGAAGGCAGGGCCTGGG + Intronic
1166563872 19:43751435-43751457 TCTGTTGAAAGGAAGGGCCTTGG - Intronic
1166566637 19:43769604-43769626 GTTCTGGGAAGGCAGGGCTAGGG + Intronic
1167355201 19:48999400-48999422 GCACATGGCAGGCAGGGCTTAGG - Intronic
1167708607 19:51097029-51097051 GGTCAGGGAAGGAAGGGCCTTGG - Intergenic
1168678387 19:58295599-58295621 ACTCATGGAAGGAGGGGCTGGGG + Exonic
925535756 2:4914714-4914736 ACCCTTGGAGAGAAGGGCTTGGG - Intergenic
926153787 2:10439406-10439428 GCTCCCGGAAGGTAGGGCTGTGG + Intergenic
926625415 2:15085988-15086010 GCTCCTGGAGGGAAGGGGTGGGG + Intergenic
927137228 2:20105805-20105827 GCTCGTGAAAGGCAGGGCTGTGG + Intergenic
930051395 2:47218712-47218734 GATATTGGGAGGAAGGGCTATGG + Intergenic
930515098 2:52396979-52397001 TCAATTGGAAGGAAGGACTTTGG + Intergenic
930978241 2:57490331-57490353 GCTGATGGGAGGAAGGGCCTGGG + Intergenic
933350806 2:81150081-81150103 CCACCTGGAAGGCAGGGCTTTGG + Intergenic
934319458 2:91959168-91959190 GACCTTGGAGGAAAGGGCTTTGG + Intergenic
935445802 2:103155397-103155419 GCTAGGGGAAGGAAGGGGTTAGG + Intergenic
935627485 2:105183414-105183436 GCTCTTGGCAAGGAGGGATTTGG + Intergenic
936125848 2:109788705-109788727 GCTCTTGGAAGGGAGGGTTCTGG - Intergenic
936218845 2:110582763-110582785 GCTCTTGGAAGGGAGGGTTCTGG + Intergenic
936388812 2:112054635-112054657 GCCCCAGGAAGGAAGAGCTTGGG - Intergenic
936388856 2:112054767-112054789 GCCCCAGGAAGGAAGAGCTTGGG - Intergenic
936388942 2:112055011-112055033 GCCCCAGGAAGGAAGAGCTTGGG - Intergenic
940493521 2:154394814-154394836 TCTCTTGGAAGGAAATGGTTTGG + Intronic
941523973 2:166583192-166583214 GCTCTTGTAAGGCAGGCCTGGGG - Intergenic
941921318 2:170853781-170853803 CTGCTTGGAAGGAGGGGCTTGGG - Intronic
942131694 2:172886137-172886159 GCTCTAGGAAGGAAAAGCATAGG - Intronic
942483396 2:176413902-176413924 GCTTTCGGAAAGTAGGGCTTTGG + Intergenic
945035325 2:205699513-205699535 GCTTTTGGAAGGAAAAACTTAGG + Intronic
945160692 2:206887377-206887399 GCTCATGGATGGCAGGGCTTCGG - Intergenic
946363483 2:219233879-219233901 GCTCTTGGAAGGTGGGTCTGCGG - Exonic
946370430 2:219278463-219278485 GCTCTGCAAAGGCAGGGCTTGGG + Intergenic
948011556 2:234652985-234653007 GCGCTGGGAAGGACAGGCTTAGG + Intergenic
948016561 2:234695783-234695805 GTTTTTGGTGGGAAGGGCTTGGG + Intergenic
948161360 2:235827593-235827615 GCCCTTGGAAGGAAGGGGAGAGG + Intronic
948483366 2:238264266-238264288 GATCTTGGAGGGCAGGGCCTGGG - Intronic
948738809 2:240029623-240029645 GCTCTGGGAATCAATGGCTTGGG + Exonic
948796578 2:240405912-240405934 GCTCTTGGGATCAAGGGCTGTGG + Intergenic
948846592 2:240685735-240685757 GCACCTGGAAGGAGGGGGTTGGG + Intergenic
948847269 2:240688999-240689021 GCACCTGGAAGGAGGGGGTTGGG - Intergenic
949061369 2:241959920-241959942 GCTCTGGGAAGGAGGTGCCTTGG - Intergenic
1168889755 20:1287351-1287373 AATCTTGGAAGGAAGGCCTACGG - Intronic
1170983678 20:21238821-21238843 GCTCTTGGAAGGCCTGGCTGAGG + Intronic
1171232508 20:23498916-23498938 GCCCCTGGAAGGCAGGGCTGTGG - Intergenic
1173110613 20:40184401-40184423 AATCTCTGAAGGAAGGGCTTAGG + Intergenic
1173908595 20:46647237-46647259 GCTCTGAGAAGGAAGAGTTTGGG - Intronic
1174280032 20:49432667-49432689 TCTCTTGGAAGGAAGCACCTTGG + Intronic
1175107233 20:56624305-56624327 TCTCTTGGAAGGAAGCTGTTTGG + Intergenic
1175321836 20:58093634-58093656 CCTGTTGGAAGGTAGGGTTTGGG - Intergenic
1175464981 20:59184812-59184834 GCTTTTGCAAAGGAGGGCTTGGG + Intergenic
1179958736 21:44756331-44756353 ACTGTTGGAAAGAAGGGGTTTGG + Intergenic
1181822031 22:25483953-25483975 GGTCTGGGAAGGAAGGGATGGGG + Intergenic
1182359355 22:29737737-29737759 CCTCTTTGAGGGAAGGGCCTCGG - Intronic
1183794877 22:40108396-40108418 GTTCTTGGAAGTTAGGGCTTAGG + Intronic
1184474441 22:44712906-44712928 GCACTGGGAAGGGAGGGGTTGGG + Intronic
1184513167 22:44944840-44944862 GGGCCTGGAAGGAAGGACTTGGG + Intronic
1185008982 22:48302644-48302666 GCTCCTGGAAGGAAGGGCCTTGG - Intergenic
949511561 3:4771194-4771216 GCTCTGTGAAGGAAGGGGTGAGG - Intronic
950488143 3:13284999-13285021 GCTCCTGAAAGGCAGGGCTGAGG - Intergenic
950876845 3:16283276-16283298 GTTCGTGGAAGGAATGACTTTGG + Intronic
952156654 3:30650589-30650611 GCTGGTGGAAAGAGGGGCTTGGG + Intronic
952727373 3:36601082-36601104 TCTCTTGGAAGGAAGAACTTTGG - Intergenic
953468532 3:43146701-43146723 TCTCTTGGAAGGGGAGGCTTAGG - Intergenic
956609506 3:71108039-71108061 CACCTTGGAAGGAAGGGCATGGG + Intronic
956877173 3:73475255-73475277 GCTTTTGGAAGGATGTGATTAGG - Intronic
958572511 3:95906133-95906155 TGTGTTGGAAGGAAGGGTTTGGG - Intergenic
958881009 3:99669848-99669870 GCTCTTTGAGGGGTGGGCTTGGG + Intronic
959521040 3:107323258-107323280 GTTCTTGGTAGGAACTGCTTTGG - Intergenic
961006811 3:123411091-123411113 GCTCATGGAGGGAACGGGTTAGG - Intronic
961636409 3:128335717-128335739 GCTCTTGGAAGAACAGGCTGCGG + Intronic
962448983 3:135495568-135495590 ACTCTTTGAAGGCAGGACTTAGG + Intergenic
965090185 3:164151505-164151527 GGTGTTGGAAGGTAGGCCTTAGG + Intergenic
965622508 3:170655509-170655531 GCTCCTGGAAGGTTGGGATTGGG + Intronic
966914531 3:184577542-184577564 GCCCTTGGGAGCAAGGCCTTGGG + Intronic
967046000 3:185737216-185737238 GCTGCTGGAAGGAAGGACATAGG - Intronic
971365453 4:25973385-25973407 GCTGTTGAAAGCAAGGGCTTTGG - Intergenic
971788497 4:31136448-31136470 GCTCTTTGCAGGAAGGGCCCAGG + Intronic
975838808 4:78452969-78452991 GCCCTTGGAAGGCAGAGTTTGGG + Intronic
975908057 4:79239354-79239376 GGTCTTGGAAGGAAGAGAATTGG + Intronic
976371797 4:84298465-84298487 GCTCTTAGAGGAAAGGGTTTTGG - Intergenic
976758613 4:88524238-88524260 GAACCTGGAAGGAAGGGCCTAGG + Intronic
979160210 4:117450013-117450035 GCTCTTGTAAGGCAGGTCTGTGG - Intergenic
979697628 4:123631792-123631814 GATCTAGGCAGGAAGGGCTCAGG - Intergenic
980448264 4:132939430-132939452 GTTCTTGGAAGCAAGGGATTTGG - Intergenic
980982374 4:139665646-139665668 GCCCTAGGAGGGAAGGGCGTGGG + Intergenic
983650421 4:170031439-170031461 TCTCCAGGAGGGAAGGGCTTTGG - Intronic
984635869 4:182108584-182108606 GATCTTGGAAGGGAGGGAATAGG - Intergenic
984702042 4:182824923-182824945 GCTCTTGGACAGAAGGGCCCAGG - Intergenic
984710698 4:182881637-182881659 CCTCTTGGAAGGCAGAGCTGCGG + Intergenic
985874023 5:2581683-2581705 GCTCTTGGAATGAGTGGCTAAGG + Intergenic
986244237 5:5990969-5990991 CACCTTGGAAGGAGGGGCTTTGG + Intergenic
988370607 5:30363409-30363431 GCTCTTGTAAGGCAGGCCTGGGG + Intergenic
988713489 5:33801955-33801977 GCTATTAGGAGGTAGGGCTTTGG + Intronic
988856449 5:35232205-35232227 GCTCTTAGAAGGCAGGGACTTGG + Intergenic
989390715 5:40897324-40897346 GCTCTTGTAAGGCAGGCCTGGGG - Intergenic
990001639 5:50900099-50900121 GCTCTTAGAAAGAACTGCTTTGG + Intergenic
990099060 5:52158651-52158673 GCTCTTGTAAGGTAGGCCTAAGG - Intergenic
991288672 5:65009544-65009566 GCCTTTGGAAGGAAATGCTTAGG + Intronic
993695332 5:91054732-91054754 GGTATTAGGAGGAAGGGCTTTGG - Intronic
994160510 5:96551384-96551406 GCTCTTGTAAGGCAGGCCTGGGG - Intronic
995225674 5:109698017-109698039 GCTCTGGGAAGGAAGGTTCTGGG + Intronic
996094474 5:119383699-119383721 TCTCTTGGAAGCAAGGGCAAGGG + Intronic
997591038 5:135072497-135072519 GCTCTTTGAAGGCAGGGACTTGG + Intronic
998076534 5:139241213-139241235 GCTCTTGGGAAGAGCGGCTTTGG - Intronic
999135293 5:149314785-149314807 GATCTTGGCAGGAAAGGCTTTGG + Intronic
999396197 5:151230100-151230122 GCTCTTGGAAGGAGAGGCATTGG - Intronic
999687917 5:154118808-154118830 GCTCTTGGGAAGGAGGCCTTGGG - Intronic
1000634072 5:163623342-163623364 GCTCTTAGAAGTAATGGCCTGGG - Intergenic
1001141120 5:169144817-169144839 GCTGTTGCAGGGTAGGGCTTAGG - Intronic
1002388319 5:178888298-178888320 ACTCTTGGAAGGCAAGGCCTGGG + Intergenic
1002471667 5:179439299-179439321 GCTCTTGGGAGGGAAGGGTTGGG - Intergenic
1004104936 6:12658531-12658553 GCCTTTGGGAGGAAGGGCTGGGG + Intergenic
1004744929 6:18500595-18500617 GCCTTTGGAAGCAAGGCCTTTGG + Intergenic
1005170821 6:22982273-22982295 GCTCTTGCAAGGCAGGCCTGGGG - Intergenic
1005785653 6:29243142-29243164 GCTCTTGTAAGGTAGGCCTGGGG + Intergenic
1005987236 6:30882852-30882874 GCTCCTGGAAGGAGGGGCTGTGG + Intronic
1006117672 6:31783994-31784016 GCCCTGGAAAGGAAGGACTTGGG - Intronic
1006317042 6:33297393-33297415 GCTCTGGGGAGAAGGGGCTTTGG - Intronic
1006385958 6:33731097-33731119 GCACCTGGAAAGATGGGCTTGGG - Intronic
1007749553 6:44063512-44063534 CCCCTTGGAATGAAGGGGTTGGG + Intergenic
1008776774 6:55049560-55049582 GCTCTTAGAAGGAAAAGCATTGG + Intergenic
1009846706 6:69144488-69144510 GATCTTAGAAGGAAGGCTTTTGG + Intronic
1009863196 6:69362461-69362483 CCTAGTGGAAGGAATGGCTTTGG - Intronic
1010459660 6:76099512-76099534 GCTCTTGTAAGGCAGGCCTGGGG - Intergenic
1012402116 6:98849225-98849247 GCTCCTGGAAGGAAGAGAGTTGG + Intergenic
1012534817 6:100282686-100282708 GCTCTTGGCAAGCAGGGCCTAGG - Intergenic
1012884387 6:104828672-104828694 CCTCTTGGAAGGAAGTGGTTTGG - Intronic
1013796488 6:113894813-113894835 GACCTGGGGAGGAAGGGCTTGGG + Intergenic
1014149920 6:118042849-118042871 GCTTTTGGAAGGGCTGGCTTGGG + Intronic
1021377683 7:19928574-19928596 TCTGTTGGAAGGGAGGGCTTAGG - Intergenic
1021464477 7:20926533-20926555 GCTCTTGTAAGGCAGGCCTGGGG + Intergenic
1021500791 7:21330102-21330124 GCTCCTGGACGGAAGGGGTTGGG - Intergenic
1023205555 7:37745639-37745661 GCTCTTGGAAGACAGGGCAATGG + Intronic
1023572070 7:41582622-41582644 GCTCTTGGAACAAAGGCCCTTGG + Intergenic
1024533880 7:50413863-50413885 GCTCTAGGGAGAAAGGCCTTAGG - Intergenic
1025759905 7:64380238-64380260 GCTCTTTGAAGGCAGGGTTCAGG - Intergenic
1026377724 7:69768810-69768832 GCTCCTGCAAGGAGGGGCCTGGG + Intronic
1026437063 7:70408254-70408276 GCACTGGGAAGGAAGGGGTCTGG + Intronic
1026839232 7:73659833-73659855 GCTCTCTGATAGAAGGGCTTTGG - Intergenic
1027867229 7:83663298-83663320 GCTCTGGGAAGGAAGGTGGTGGG - Intergenic
1028707294 7:93864823-93864845 GTTCTTGGAGGGAAGGGGCTGGG + Intronic
1029200164 7:98834045-98834067 GGTTTTGGAGGGAAGGGCTGGGG + Intergenic
1031269020 7:119621157-119621179 ACTCATGGAAGGAAGGGTCTAGG + Intergenic
1032956912 7:136982617-136982639 GCTCTTGTAAGGCAGGCCTGGGG + Intronic
1033606466 7:142931646-142931668 GCTATTGGAAGAGAGGGATTTGG - Intronic
1035702146 8:1644260-1644282 GCTCTTGGTCGGGCGGGCTTAGG - Intronic
1036417525 8:8564426-8564448 GCTCGTGGAACGAAGGGCAGTGG - Intergenic
1037759770 8:21734088-21734110 AGGCTTGGAAGGAAGGGGTTGGG - Intronic
1045017841 8:98014169-98014191 GCTCCAGGAAGGAAGGGCTTAGG + Intronic
1045111966 8:98944857-98944879 CCCTTTGGAAGGAAGGGTTTGGG + Intronic
1045555843 8:103213697-103213719 GCTCTTAGTAGGCAGGGCTCAGG + Intronic
1046972331 8:120236793-120236815 GCTCTTGTAAGGCAGGCCTGGGG + Intronic
1048317610 8:133373856-133373878 GCTCATGGAAAGAAAGGCTGGGG + Intergenic
1048375693 8:133820419-133820441 GCTCTGGGAAGGAAGGGGCCCGG + Intergenic
1051816298 9:21110467-21110489 GCTCTTAGAAGGAATGCATTTGG + Intergenic
1053152342 9:35751000-35751022 GCTCCTGGAGGGAAGGGCTGGGG + Intronic
1053228403 9:36382676-36382698 GCTTTGGGAAGGAAGTCCTTAGG - Intronic
1053409534 9:37906598-37906620 GCTGTTGGAAGGCAGGGCCTGGG + Intronic
1056123932 9:83515935-83515957 GCTCTTGTAAGGCAGGCCTGGGG - Intronic
1056293951 9:85172839-85172861 GCTGTTTGAAGGCTGGGCTTTGG + Intergenic
1056475544 9:86947857-86947879 GGGCTTGAAAGGAACGGCTTAGG + Intergenic
1057018137 9:91672741-91672763 GCTCTTGCAAGGCAGGCCTGGGG + Intronic
1057941773 9:99291395-99291417 GTCCCTGGAAGGAAGGGGTTAGG + Intergenic
1061328801 9:129879705-129879727 GCTCCTGGAAGGACGGGACTGGG - Intronic
1061360768 9:130140954-130140976 GCGTTTTGAAGGCAGGGCTTTGG - Intergenic
1062044967 9:134420777-134420799 GCTCCTGGCAGGTGGGGCTTGGG - Intronic
1062652784 9:137586886-137586908 CCTCTTGGAAACAAGAGCTTTGG + Intronic
1185783446 X:2868656-2868678 GCTTTTAAAAGGAAGGGATTGGG + Intronic
1186189232 X:7052830-7052852 GCTGTTGGAAGGGAGGTGTTGGG - Intronic
1186387458 X:9124638-9124660 GCTATGGGTAGGAAGGGGTTAGG - Intronic
1187828977 X:23361825-23361847 GCTCTTGTAAGGCAGGCCTGGGG + Intronic
1189216200 X:39326953-39326975 GCTCTGGGAGGGGAAGGCTTTGG - Intergenic
1191931155 X:66374817-66374839 GCTCTTGTAAGGAAGGCCTGAGG + Intergenic
1192235307 X:69291787-69291809 GCTCTTGCAAGGGAAGGCTGTGG - Intergenic
1192237599 X:69305939-69305961 GCTCTGGGAAGGAAGGCCTGGGG - Intergenic
1193622085 X:83766034-83766056 GCTCTTGGTAGAAATTGCTTTGG + Intergenic
1193635185 X:83942128-83942150 GCTCCTGTAAGGAAGGTCTGGGG + Intergenic
1193784328 X:85740825-85740847 GCTCTTGTAAGGCAGGCCTCAGG - Intergenic
1194782934 X:98047526-98047548 GCTCTTGTAAGGCAGGCTTTTGG + Intergenic
1194969353 X:100325897-100325919 CCTATTGGAAAGTAGGGCTTGGG - Intronic
1194978591 X:100417127-100417149 GCTTTTGGAAGAAAGGTCATTGG - Intergenic
1197261926 X:124328898-124328920 ACTCTTGGAGGGAAGGGCAGGGG - Intronic
1198272080 X:135064586-135064608 GGTCTGGGGAGGAAGAGCTTTGG - Intergenic
1198364690 X:135928706-135928728 GAACTGGGAAGGAAGGACTTAGG - Intergenic
1201519737 Y:14860248-14860270 GCTCTTGTAAGGCAGGTCTGGGG - Intergenic
1202259581 Y:22956509-22956531 GCTCTTTGTAGGCAGGGTTTAGG - Intergenic
1202412567 Y:24590253-24590275 GCTCTTTGTAGGCAGGGTTTAGG - Intergenic
1202458213 Y:25079817-25079839 GCTCTTTGTAGGCAGGGTTTAGG + Intergenic